MD15G1392700.v1.1

Plastocyanin-like domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
48993788 .. 48994892
1105 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1392700.v1.1.491

Sequence Viewer

Length: 204 bp
ATGAGCATACTGACTGCTGCTCCAACTTTGAGGATGTGGATGTGGATGAGCTTCGAGCATTGTGACCAGTATGCTGGGGGGATGGATAGATATCATTCAAGAAACGATCATGTGGTGTTAAAGAAAGGTATAAATTATTTCATACCTAGTGCTAGTGGATCTTATTGTGAAAAGGGAAAGAAAATTTCAATTGATGCGGAGTGA

Protein Analysis

68

Amino Acids

7.67

Weight (kDa)

7.81

Isoelectric Point (pI)

43.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 197
AclWI GGATC 1 cut(s) 166
AcsI RAATTY 1 cut(s) 183
AgsI TTSAA 2 cut(s) 99, 189
AluBI AGCT 1 cut(s) 51
AluI AGCT 1 cut(s) 51
AlwI GGATC 1 cut(s) 166
ApeKI GCWGC 1 cut(s) 17
ApoI RAATTY 1 cut(s) 183
BbvI GCAGC 1 cut(s) 4
BccI CCATC 1 cut(s) 76
BfaI CTAG 2 cut(s) 147, 153
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
BmsI GCATC 1 cut(s) 184
BsaBI GATNNNNATC 1 cut(s) 90
BsaXI ACNNNNNCTCC 1 cut(s) 34
Bse1I ACTGG 1 cut(s) 67
Bse8I GATNNNNATC 1 cut(s) 90
BseGI GGATG 4 cut(s) 39, 45, 51, 87
BseJI GATNNNNATC 1 cut(s) 90
BseNI ACTGG 1 cut(s) 67
BseXI GCAGC 1 cut(s) 4
BseYI CCCAGC 1 cut(s) 74
Bsp143I GATC 2 cut(s) 106, 158
BspACI CCGC 1 cut(s) 197
BspPI GGATC 1 cut(s) 166
BsrI ACTGG 1 cut(s) 67
BssMI GATC 2 cut(s) 106, 158
BstF5I GGATG 4 cut(s) 39, 45, 51, 87
BstKTI GATC 2 cut(s) 109, 161
BstMBI GATC 2 cut(s) 106, 158
BstV1I GCAGC 1 cut(s) 4
BstX2I RGATCY 1 cut(s) 158
BstXI CCANNNNNNTGG 1 cut(s) 74
BstYI RGATCY 1 cut(s) 158
BtsCI GGATG 4 cut(s) 39, 45, 51, 87
CviAII CATG 1 cut(s) 110
CviJI RGCY 1 cut(s) 51
CviKI_1 RGCY 1 cut(s) 51
DpnI GATC 2 cut(s) 108, 160
DpnII GATC 2 cut(s) 106, 158
Eco32I GATATC 1 cut(s) 92
EcoRV GATATC 1 cut(s) 92
FaeI CATG 1 cut(s) 113
FaiI YATR 5 cut(s) 8, 72, 111, 131, 143
FatI CATG 1 cut(s) 109
Fnu4HI GCNGC 1 cut(s) 18
FokI GGATG 4 cut(s) 46, 52, 58, 94
Fsp4HI GCNGC 1 cut(s) 18
FspBI CTAG 2 cut(s) 147, 153
GluI GCNGC 1 cut(s) 18
GsaI CCCAGC 1 cut(s) 78
Hin1II CATG 1 cut(s) 113
Hpy188III TCNNGA 1 cut(s) 99
Hsp92II CATG 1 cut(s) 113
Kzo9I GATC 2 cut(s) 106, 158
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 2 cut(s) 60, 80
Lsp1109I GCAGC 1 cut(s) 4
LweI GCATC 1 cut(s) 184
MaeI CTAG 2 cut(s) 147, 153
MaeIII GTNAC 1 cut(s) 62
MalI GATC 2 cut(s) 108, 160
MboI GATC 2 cut(s) 106, 158
MfeI CAATTG 1 cut(s) 189
MflI RGATCY 1 cut(s) 158
MluCI AATT 3 cut(s) 133, 183, 189
MmeI TCCRAC 1 cut(s) 47
MnlI CCTC 1 cut(s) 24
MseI TTAA 1 cut(s) 119
MunI CAATTG 1 cut(s) 189
NdeII GATC 2 cut(s) 106, 158
NlaIII CATG 1 cut(s) 113
NmuCI GTSAC 1 cut(s) 62
PkrI GCNGC 1 cut(s) 19
PspFI CCCAGC 1 cut(s) 74
PsuI RGATCY 1 cut(s) 158
SaqAI TTAA 1 cut(s) 119
SatI GCNGC 1 cut(s) 18
Sau3AI GATC 2 cut(s) 106, 158
SetI ASST 3 cut(s) 53, 130, 148
SfaNI GCATC 1 cut(s) 184
SgeI CNNG 7 cut(s) 67, 79, 87, 111, 122, 159, 165
Sse9I AATT 3 cut(s) 133, 183, 189
SsiI CCGC 1 cut(s) 197
SspMI CTAG 2 cut(s) 147, 153
TaqI TCGA 1 cut(s) 54
TasI AATT 3 cut(s) 133, 183, 189
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TseFI GTSAC 1 cut(s) 62
TseI GCWGC 1 cut(s) 17
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 1 cut(s) 130
XapI RAATTY 1 cut(s) 183
XspI CTAG 2 cut(s) 147, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.