MD17G1077600.v1.1

K homology RNA-binding domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
6406761 .. 6407621
861 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1077600.v1.1.491

Sequence Viewer

Length: 168 bp
ATGATGGATGGGAACAATCGAAACTTTTTCAAGAAATGCCGTAATATCCAGTTTAAAAGAAGAGGGGGTAACAACAACTATAAGAAAGGAAAGTGGAATGATTCAAGCCGTAAGCAACCTTCAGAGGATTATCAATTGCTCAACACTGTGTATCGTATTCTCTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.68

Weight (kDa)

10.18

Isoelectric Point (pI)

51.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 105
AgsI TTSAA 2 cut(s) 31, 105
BarI GAAGNNNNNNTAC 2 cut(s) 103, 135
BccI CCATC 1 cut(s) 2
BceAI ACGGC 2 cut(s) 24, 93
Bse1I ACTGG 1 cut(s) 49
BseGI GGATG 1 cut(s) 13
BseNI ACTGG 1 cut(s) 49
BsrI ACTGG 1 cut(s) 49
Bst4CI ACNGT 1 cut(s) 148
Bst6I CTCTTC 1 cut(s) 55
BstF5I GGATG 1 cut(s) 13
BtsCI GGATG 1 cut(s) 13
BtsIMutI CAGTG 1 cut(s) 144
CviJI RGCY 1 cut(s) 108
CviKI_1 RGCY 1 cut(s) 108
DraI TTTAAA 1 cut(s) 55
Eam1104I CTCTTC 1 cut(s) 55
EarI CTCTTC 1 cut(s) 55
Eco57I CTGAAG 1 cut(s) 105
FaiI YATR 1 cut(s) 81
FokI GGATG 1 cut(s) 20
HinfI GANTC 1 cut(s) 101
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 129
HpyCH4III ACNGT 1 cut(s) 148
LpnPI CCDG 1 cut(s) 62
MaeIII GTNAC 1 cut(s) 68
MboII GAAGA 1 cut(s) 72
MfeI CAATTG 1 cut(s) 134
MluCI AATT 1 cut(s) 134
MnlI CCTC 2 cut(s) 56, 118
MseI TTAA 1 cut(s) 54
MunI CAATTG 1 cut(s) 134
PfeI GAWTC 1 cut(s) 101
SaqAI TTAA 1 cut(s) 54
SetI ASST 1 cut(s) 121
SgeI CNNG 3 cut(s) 43, 61, 117
Sse9I AATT 1 cut(s) 134
TaaI ACNGT 1 cut(s) 148
TaqI TCGA 1 cut(s) 19
TasI AATT 1 cut(s) 134
TfiI GAWTC 1 cut(s) 101
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 1 cut(s) 151
TspRI CASTG 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.