Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0004005

Physical Location & Seq

Genomic Coordinates Forward (+)

41698484 .. 41699296

Gene Structure 813 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G504300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 429 bp

ATGGGTTTGATGCCTAATCTTCAACTGGGTATTAGATACTCTATTGGGAAGCATGCTTCGATAGTGAGGGAAATTAAGCCCAGTGATTTCGATCCCAAAGAGAAGTTCTGGGCCAGTTGTTCTTTGATTGGAAATCAGACGAGGTTTATCGTGATGGGCAATTTGTTCTGCTCGGATTACAGAATACATAGACGATTTGACCTAAAAGGATCATCCCATGGTCGAACAACTGATAAGCCTGAGGGGGAAATCGATGAAATCACAACTCTCAAGGACTTGGATCTTAATTTTGTGTTTCGCCTCCAAGGAAAATGGTTCCAAGACCTTATGAATATGAACATTGGCAGGCAAATTGATCTAGATTGTCAATTTCTGGAAGCAGAGAGAATCATGGATTATAGTCTTCCTCCTCCCATCGGTGATTTGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003779 GO:0003785 GO:0003824 GO:0005488 GO:0005515 GO:0005575 GO:0005623 GO:0005886 GO:0006629 GO:0006644 GO:0006650 GO:0006793 GO:0006796 GO:0007275 GO:0008092 GO:0008150 GO:0008152 GO:0009605 GO:0009606 GO:0009628 GO:0009629 GO:0009630 GO:0009653 GO:0009791 GO:0009958 GO:0009987 GO:0010015 GO:0010101 GO:0010102 GO:0010311 GO:0016020 GO:0016301 GO:0016307 GO:0016308 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019637 GO:0022414 GO:0022622 GO:0030258 GO:0032501 GO:0032502 GO:0040007 GO:0044237 GO:0044238 GO:0044255 GO:0044464 GO:0044877 GO:0046486 GO:0046488 GO:0046834 GO:0046854 GO:0048364 GO:0048527 GO:0048528 GO:0048646 GO:0048731 GO:0048856 GO:0050896 GO:0051015 GO:0071704 GO:0071944 GO:0090696 GO:0090697 GO:0090698 GO:0099402 GO:1905392 GO:1905393

KEGG Pathways

Metabolic & Signaling

ko00562 ko01100 ko04011 ko04070 ko04072 ko04139 ko04144 ko04666 ko04810 ko05231 map00562 map01100 map04011 map04070 map04072 map04139 map04144 map04666 map04810 map05231

Pfam Domains

Protein Families

MORN PIP5K

Protein Analysis

143

Amino Acids

16.43

Weight (kDa)

5.9

Isoelectric Point (pI)

28.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004005)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G41210 AT3G56960 AT3G56960
fragaria_vesca	FvH4_6g25450
malus_domestica	MD14G1087700.v1.1
prunus_persica	Prupe.1G504300_v2.0.a1 Prupe.3G181700_v2.0.a1 Prupe.7G038800_v2.0.a1 Prupe.8G042800_v2.0.a1
pyrus_communis	pycom1481g00110 pycom14g07780
rosa_chinensis	RchiOBHm_Chr2g0125511 RchiOBHm_Chr3g0486631 RchiOBHm_Chr4g0389821 RchiOBHm_Chr4g0389831 RchiOBHm_Chr7g0202621
rosa_laevigata	RLG00000004364 RLG00000014288 RLG00000018868
rosa_multiflora	Rmu_co8380969.1_g000001 Rmu_sc0001493.1_g000011 Rmu_sc0004504.1_g000001
rosa_roxburghii	Rroxscaffold_2G00117950
rosa_rugosa	Rorug02G0257800 Rorug02G0257800
rosa_samantha	Rh2AG316600 Rh2AG506900 Rh2BG324300 Rh2CG306400 Rh2DG342700 Rh5AG307600
rosa_wichuraiana	Rw2G025540 Rw3G020770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	86, 217, 288
AfiI	CCNNNNNNNGG	1 cut(s)	416
AgsI	TTSAA	1 cut(s)	23
AjuI	GAANNNNNNNTTGG	2 cut(s)	89, 121
AlwI	GGATC	3 cut(s)	86, 217, 288
AoxI	GGCC	1 cut(s)	111
AspS9I	GGNCC	1 cut(s)	111
AxyI	CCTNAGG	1 cut(s)	240
BbsI	GAAGAC	1 cut(s)	395
BccI	CCATC	2 cut(s)	148, 422
BfaI	CTAG	1 cut(s)	359
BmgT120I	GGNCC	1 cut(s)	111
BmiI	GGNNCC	1 cut(s)	317
BmrI	ACTGGG	2 cut(s)	35, 75
BmuI	ACTGGG	2 cut(s)	35, 75
BpiI	GAAGAC	1 cut(s)	395
BpuEI	CTTGAG	1 cut(s)	254
Bsa29I	ATCGAT	1 cut(s)	252
BsaBI	GATNNNNATC	1 cut(s)	90
BsaJI	CCNNGG	2 cut(s)	217, 304
Bsc4I	CCNNNNNNNGG	1 cut(s)	416
Bse1I	ACTGG	3 cut(s)	30, 81, 114
Bse21I	CCTNAGG	1 cut(s)	240
Bse8I	GATNNNNATC	1 cut(s)	90
BseCI	ATCGAT	1 cut(s)	252
BseDI	CCNNGG	2 cut(s)	217, 304
BseGI	GGATG	1 cut(s)	212
BseJI	GATNNNNATC	1 cut(s)	90
BseLI	CCNNNNNNNGG	1 cut(s)	416
BseMII	CTCAG	1 cut(s)	231
BseNI	ACTGG	3 cut(s)	30, 81, 114
BseRI	GAGGAG	1 cut(s)	399
BshFI	GGCC	1 cut(s)	113
BshVI	ATCGAT	1 cut(s)	252
BslI	CCNNNNNNNGG	1 cut(s)	416
BsnI	GGCC	1 cut(s)	113
Bsp143I	GATC	4 cut(s)	91, 209, 280, 355
Bsp19I	CCATGG	1 cut(s)	217
BspANI	GGCC	1 cut(s)	113
BspCNI	CTCAG	1 cut(s)	232
BspDI	ATCGAT	1 cut(s)	252
BspLI	GGNNCC	1 cut(s)	317
BspPI	GGATC	3 cut(s)	86, 217, 288
BsrI	ACTGG	3 cut(s)	30, 81, 114
BssECI	CCNNGG	2 cut(s)	217, 304
BssMI	GATC	4 cut(s)	91, 209, 280, 355
BssT1I	CCWWGG	2 cut(s)	217, 304
BstC8I	GCNNGC	2 cut(s)	54, 347
BstDEI	CTNAG	1 cut(s)	240
BstDSI	CCRYGG	1 cut(s)	217
BstF5I	GGATG	1 cut(s)	212
BstKTI	GATC	4 cut(s)	94, 212, 283, 358
BstMBI	GATC	4 cut(s)	91, 209, 280, 355
BstNSI	RCATGY	1 cut(s)	56
BstV2I	GAAGAC	1 cut(s)	395
BstX2I	RGATCY	1 cut(s)	280
BstYI	RGATCY	1 cut(s)	280
Bsu15I	ATCGAT	1 cut(s)	252
Bsu36I	CCTNAGG	1 cut(s)	240
BsuRI	GGCC	1 cut(s)	113
BsuTUI	ATCGAT	1 cut(s)	252
BtgI	CCRYGG	1 cut(s)	217
BtsCI	GGATG	1 cut(s)	212
BtsIMutI	CAGTG	1 cut(s)	88
Cac8I	GCNNGC	2 cut(s)	54, 347
Cfr13I	GGNCC	1 cut(s)	111
ClaI	ATCGAT	1 cut(s)	252
CviAII	CATG	3 cut(s)	53, 218, 391
CviJI	RGCY	3 cut(s)	79, 113, 238
CviKI_1	RGCY	3 cut(s)	79, 113, 238
DdeI	CTNAG	1 cut(s)	240
DpnI	GATC	4 cut(s)	93, 211, 282, 357
DpnII	GATC	4 cut(s)	91, 209, 280, 355
Eco130I	CCWWGG	2 cut(s)	217, 304
Eco81I	CCTNAGG	1 cut(s)	240
EcoT14I	CCWWGG	2 cut(s)	217, 304
ErhI	CCWWGG	2 cut(s)	217, 304
FaeI	CATG	3 cut(s)	56, 221, 394
FaiI	YATR	7 cut(s)	54, 189, 219, 329, 335, 392, 399
FatI	CATG	3 cut(s)	52, 217, 390
FokI	GGATG	1 cut(s)	199
FspBI	CTAG	1 cut(s)	359
HaeIII	GGCC	1 cut(s)	113
Hin1II	CATG	3 cut(s)	56, 221, 394
HinfI	GANTC	1 cut(s)	387
Hpy188I	TCNGA	2 cut(s)	138, 175
Hpy188III	TCNNGA	3 cut(s)	151, 359, 374
HpyF3I	CTNAG	1 cut(s)	240
Hsp92II	CATG	3 cut(s)	56, 221, 394
Kzo9I	GATC	4 cut(s)	91, 209, 280, 355
LpnPI	CCDG	7 cut(s)	11, 94, 94, 127, 252, 331, 359
MaeI	CTAG	1 cut(s)	359
MalI	GATC	4 cut(s)	93, 211, 282, 357
MboI	GATC	4 cut(s)	91, 209, 280, 355
MboII	GAAGA	2 cut(s)	11, 395
MflI	RGATCY	1 cut(s)	280
MluCI	AATT	5 cut(s)	72, 160, 286, 351, 368
MnlI	CCTC	6 cut(s)	60, 135, 235, 311, 417, 420
MseI	TTAA	2 cut(s)	75, 285
NcoI	CCATGG	1 cut(s)	217
NdeII	GATC	4 cut(s)	91, 209, 280, 355
NlaIII	CATG	3 cut(s)	56, 221, 394
NlaIV	GGNNCC	1 cut(s)	317
NspI	RCATGY	1 cut(s)	56
PaeI	GCATGC	1 cut(s)	56
PfeI	GAWTC	1 cut(s)	387
PspN4I	GGNNCC	1 cut(s)	317
PspPI	GGNCC	1 cut(s)	111
PsuI	RGATCY	1 cut(s)	280
SaqAI	TTAA	2 cut(s)	75, 285
Sau3AI	GATC	4 cut(s)	91, 209, 280, 355
Sau96I	GGNCC	1 cut(s)	111
SetI	ASST	3 cut(s)	146, 204, 327
SmlI	CTYRAG	1 cut(s)	269
SmoI	CTYRAG	1 cut(s)	269
SphI	GCATGC	1 cut(s)	56
Sse9I	AATT	5 cut(s)	72, 160, 286, 351, 368
SspMI	CTAG	1 cut(s)	359
StyI	CCWWGG	2 cut(s)	217, 304
TaqI	TCGA	4 cut(s)	59, 90, 223, 252
TasI	AATT	5 cut(s)	72, 160, 286, 351, 368
TfiI	GAWTC	1 cut(s)	387
Tru1I	TTAA	2 cut(s)	75, 285
Tru9I	TTAA	2 cut(s)	75, 285
TscAI	CASTG	1 cut(s)	88
TspDTI	ATGAA	3 cut(s)	270, 344, 350
TspRI	CASTG	1 cut(s)	88
XbaI	TCTAGA	1 cut(s)	358
XceI	RCATGY	1 cut(s)	56
XspI	CTAG	1 cut(s)	359

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.