Rh2AG506900

phosphatidylinositol 4-phosphate 5-kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
72919646 .. 72920791
1146 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG506900.1

Sequence Viewer

Length: 236 bp
ATGATTGAGGTGGCCTTTTGTCAGTGTGTGGCTGCTAAGGGAAGAAAAATGGATAAGCTTGGAATTAGGCATTCTGTTGGAAGACCAGGGCGGTCTGGATCCCTTGATCTAAAGCCTTCGGCTTTCGACCCCAGAGAAAAATATTGGACAAGGTTTCCTCCTCAAGGATCCAAATACACTCCACCACACCAATCTTGTGAATTTAAATGGAAGGATTATTGTCCTTTAGTCTTCAG

Protein Analysis

78

Amino Acids

8.96

Weight (kDa)

9.55

Isoelectric Point (pI)

38.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 91
AclWI GGATC 4 cut(s) 93, 106, 162, 175
AcsI RAATTY 1 cut(s) 200
AcuI CTGAAG 1 cut(s) 217
AfiI CCNNNNNNNGG 1 cut(s) 164
AjnI CCWGG 1 cut(s) 85
AluBI AGCT 1 cut(s) 58
AluI AGCT 1 cut(s) 58
AlwI GGATC 4 cut(s) 93, 106, 162, 175
AoxI GGCC 1 cut(s) 12
ApeKI GCWGC 1 cut(s) 32
ApoI RAATTY 1 cut(s) 200
BamHI GGATCC 2 cut(s) 98, 167
BbsI GAAGAC 2 cut(s) 88, 223
BbvI GCAGC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 87
BisI GCNGC 1 cut(s) 33
BlsI GCNGC 1 cut(s) 34
Bme1390I CCNGG 1 cut(s) 87
BmiI GGNNCC 2 cut(s) 100, 169
BmrFI CCNGG 1 cut(s) 87
BpiI GAAGAC 2 cut(s) 88, 223
Bpu10I CCTNAGC 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 86
Bsc4I CCNNNNNNNGG 1 cut(s) 164
BseBI CCWGG 1 cut(s) 87
BseDI CCNNGG 1 cut(s) 86
BseLI CCNNNNNNNGG 1 cut(s) 164
BseRI GAGGAG 1 cut(s) 150
BseXI GCAGC 1 cut(s) 19
BshFI GGCC 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 164
BsmI GAATGC 1 cut(s) 70
BsnI GGCC 1 cut(s) 14
Bsp143I GATC 3 cut(s) 98, 106, 167
BspACI CCGC 1 cut(s) 91
BspANI GGCC 1 cut(s) 14
BspLI GGNNCC 2 cut(s) 100, 169
BspPI GGATC 4 cut(s) 93, 106, 162, 175
BssECI CCNNGG 1 cut(s) 86
BssMI GATC 3 cut(s) 98, 106, 167
Bst2UI CCWGG 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 36
BstENI CCTNNNNNAGG 1 cut(s) 162
BstKTI GATC 3 cut(s) 101, 109, 170
BstMBI GATC 3 cut(s) 98, 106, 167
BstNI CCWGG 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 85
BstV1I GCAGC 1 cut(s) 19
BstV2I GAAGAC 2 cut(s) 88, 223
BstX2I RGATCY 2 cut(s) 98, 167
BstYI RGATCY 2 cut(s) 98, 167
BsuRI GGCC 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 29
CviJI RGCY 5 cut(s) 14, 32, 58, 115, 122
CviKI_1 RGCY 5 cut(s) 14, 32, 58, 115, 122
DdeI CTNAG 1 cut(s) 36
DpnI GATC 3 cut(s) 100, 108, 169
DpnII GATC 3 cut(s) 98, 106, 167
DraI TTTAAA 1 cut(s) 205
Eco57I CTGAAG 1 cut(s) 217
EcoNI CCTNNNNNAGG 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 85
Fnu4HI GCNGC 1 cut(s) 33
Fsp4HI GCNGC 1 cut(s) 33
GluI GCNGC 1 cut(s) 33
HaeIII GGCC 1 cut(s) 14
HindIII AAGCTT 1 cut(s) 56
Hpy188III TCNNGA 1 cut(s) 96
HpyAV CCTTC 2 cut(s) 126, 205
HpyF3I CTNAG 1 cut(s) 36
Kzo9I GATC 3 cut(s) 98, 106, 167
LpnPI CCDG 4 cut(s) 72, 81, 99, 145
Lsp1109I GCAGC 1 cut(s) 19
MalI GATC 3 cut(s) 100, 108, 169
MboI GATC 3 cut(s) 98, 106, 167
MboII GAAGA 3 cut(s) 54, 93, 223
MflI RGATCY 2 cut(s) 98, 167
MluCI AATT 2 cut(s) 63, 200
MmeI TCCRAC 1 cut(s) 58
MnlI CCTC 2 cut(s) 168, 171
MseI TTAA 1 cut(s) 204
MspR9I CCNGG 1 cut(s) 87
Mva1269I GAATGC 1 cut(s) 70
MvaI CCWGG 1 cut(s) 87
NdeII GATC 3 cut(s) 98, 106, 167
NlaIV GGNNCC 2 cut(s) 100, 169
PctI GAATGC 1 cut(s) 70
PkrI GCNGC 1 cut(s) 34
Psp6I CCWGG 1 cut(s) 85
PspGI CCWGG 1 cut(s) 85
PspN4I GGNNCC 2 cut(s) 100, 169
PsuI RGATCY 2 cut(s) 98, 167
SaqAI TTAA 1 cut(s) 204
SatI GCNGC 1 cut(s) 33
Sau3AI GATC 3 cut(s) 98, 106, 167
ScrFI CCNGG 1 cut(s) 87
SetI ASST 3 cut(s) 12, 60, 155
SgeI CNNG 9 cut(s) 71, 98, 99, 108, 116, 144, 162, 176, 207
SmiI ATTTAAAT 1 cut(s) 205
SmlI CTYRAG 1 cut(s) 162
SmoI CTYRAG 1 cut(s) 162
Sse9I AATT 2 cut(s) 63, 200
SsiI CCGC 1 cut(s) 91
SspI AATATT 1 cut(s) 143
StyD4I CCNGG 1 cut(s) 85
SwaI ATTTAAAT 1 cut(s) 205
TaqI TCGA 1 cut(s) 126
TasI AATT 2 cut(s) 63, 200
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TscAI CASTG 1 cut(s) 29
TseI GCWGC 1 cut(s) 32
TspRI CASTG 1 cut(s) 29
XagI CCTNNNNNAGG 1 cut(s) 162
XapI RAATTY 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.