RchiOBHm_Chr7g0202621

phosphatidylinositol 4-phosphate 5-kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
20207333 .. 20211711
4379 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18139

Sequence Viewer

Length: 177 bp
ATGCTCTCTATCTGTGGGAACAATGCTGTTCGAGAACTTTCTTCTCCTGGTAAAAGTGGTAACTTCTTTTACTTGACTAATGATGACCGATACGTGATTAAAACAATGAAGAAAGCAGAAGTAAAAGTTCTTATAAGGATGCTCTCTGCCTATTACAACCATGTTCGAGCATACTAG

Protein Analysis

58

Amino Acids

6.68

Weight (kDa)

9.66

Isoelectric Point (pI)

12.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PIP5K PF01504 4 - 57 1.4e-21 Phosphatidylinositol-4-phosphate 5-Kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 134
AjnI CCWGG 1 cut(s) 46
BciT130I CCWGG 1 cut(s) 48
BfaI CTAG 1 cut(s) 175
Bme1390I CCNGG 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 48
BmsI GCATC 1 cut(s) 129
BsaAI YACGTR 1 cut(s) 94
BseBI CCWGG 1 cut(s) 48
BseGI GGATG 1 cut(s) 144
Bst2UI CCWGG 1 cut(s) 48
BstBAI YACGTR 1 cut(s) 94
BstF5I GGATG 1 cut(s) 144
BstNI CCWGG 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 46
BtsCI GGATG 1 cut(s) 144
CviAII CATG 1 cut(s) 161
EcoRII CCWGG 1 cut(s) 46
FaeI CATG 1 cut(s) 164
FaiI YATR 3 cut(s) 134, 162, 172
FatI CATG 1 cut(s) 160
FokI GGATG 1 cut(s) 151
FspBI CTAG 1 cut(s) 175
FspEI CC 7 cut(s) 33, 42, 60, 101, 121, 163, 173
Hin1II CATG 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 32
HpyCH4IV ACGT 1 cut(s) 93
HpySE526I ACGT 1 cut(s) 93
Hsp92II CATG 1 cut(s) 164
LpnPI CCDG 2 cut(s) 33, 60
LweI GCATC 1 cut(s) 129
MaeI CTAG 1 cut(s) 175
MaeII ACGT 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 59
MboII GAAGA 2 cut(s) 33, 121
MseI TTAA 1 cut(s) 99
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
NlaIII CATG 1 cut(s) 164
Ppu21I YACGTR 1 cut(s) 94
PsiI TTATAA 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
SaqAI TTAA 1 cut(s) 99
ScrFI CCNGG 1 cut(s) 48
SetI ASST 1 cut(s) 96
SfaNI GCATC 1 cut(s) 129
SgeI CNNG 6 cut(s) 44, 59, 60, 85, 106, 173
SspMI CTAG 1 cut(s) 175
StyD4I CCNGG 1 cut(s) 46
TaiI ACGT 1 cut(s) 96
TaqI TCGA 2 cut(s) 31, 166
TaqII GACCGA 1 cut(s) 102
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TspDTI ATGAA 1 cut(s) 122
XspI CTAG 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.