Prupe.4G243200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
16058056 .. 16058263
208 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G243200.1

Sequence Viewer

Length: 135 bp
ATGTGGACAGGAAATAACGTCACGAGGTCATTTAGAGTAGCTGGAGCAGCTGCACTGGCACTCCTGATTGACAAAGTGGCTGTGCCATGTTTGACAGTTGTTGGCTTGCTTATCCTCTCTAGATGGGGAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

4.68

Weight (kDa)

10.92

Isoelectric Point (pI)

27.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 41, 50
AluI AGCT 2 cut(s) 41, 50
ApeKI GCWGC 2 cut(s) 47, 50
BauI CACGAG 1 cut(s) 22
BbvI GCAGC 2 cut(s) 37, 59
BccI CCATC 1 cut(s) 117
BfaI CTAG 1 cut(s) 120
BisI GCNGC 2 cut(s) 48, 51
BlsI GCNGC 2 cut(s) 49, 52
BpmI CTGGAG 1 cut(s) 63
BsaXI ACNNNNNCTCC 2 cut(s) 45, 75
Bse1I ACTGG 1 cut(s) 60
BseNI ACTGG 1 cut(s) 60
BseXI GCAGC 2 cut(s) 37, 59
BsgI GTGCAG 1 cut(s) 36
BsrI ACTGG 1 cut(s) 60
BssSI CACGAG 1 cut(s) 22
Bst2BI CACGAG 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 107
BstMWI GCNNNNNNNGC 2 cut(s) 47, 56
BstV1I GCAGC 2 cut(s) 37, 59
BtsIMutI CAGTG 1 cut(s) 53
Cac8I GCNNGC 1 cut(s) 107
CviAII CATG 1 cut(s) 87
CviJI RGCY 4 cut(s) 41, 50, 80, 105
CviKI_1 RGCY 4 cut(s) 41, 50, 80, 105
FaeI CATG 1 cut(s) 90
FaiI YATR 1 cut(s) 88
FatI CATG 1 cut(s) 86
Fnu4HI GCNGC 2 cut(s) 48, 51
Fsp4HI GCNGC 2 cut(s) 48, 51
FspBI CTAG 1 cut(s) 120
GluI GCNGC 2 cut(s) 48, 51
GsuI CTGGAG 1 cut(s) 63
Hin1II CATG 1 cut(s) 90
Hpy166II GTNNAC 1 cut(s) 6
Hpy188III TCNNGA 3 cut(s) 22, 64, 120
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4IV ACGT 1 cut(s) 18
HpyCH4V TGCA 1 cut(s) 53
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 56
HpySE526I ACGT 1 cut(s) 18
Hsp92II CATG 1 cut(s) 90
LmnI GCTCC 1 cut(s) 44
LpnPI CCDG 3 cut(s) 27, 41, 77
Lsp1109I GCAGC 2 cut(s) 37, 59
MaeI CTAG 1 cut(s) 120
MaeII ACGT 1 cut(s) 18
MaeIII GTNAC 1 cut(s) 19
MnlI CCTC 2 cut(s) 18, 125
MspA1I CMGCKG 1 cut(s) 50
MwoI GCNNNNNNNGC 2 cut(s) 47, 56
NlaIII CATG 1 cut(s) 90
NmuCI GTSAC 1 cut(s) 19
PkrI GCNGC 2 cut(s) 49, 52
PvuII CAGCTG 1 cut(s) 50
SatI GCNGC 2 cut(s) 48, 51
SetI ASST 4 cut(s) 21, 29, 43, 52
SgeI CNNG 8 cut(s) 21, 34, 36, 54, 68, 76, 99, 118
SspMI CTAG 1 cut(s) 120
TaaI ACNGT 1 cut(s) 97
TaiI ACGT 1 cut(s) 21
TscAI CASTG 1 cut(s) 60
TseFI GTSAC 1 cut(s) 19
TseI GCWGC 2 cut(s) 47, 50
Tsp45I GTSAC 1 cut(s) 19
TspRI CASTG 1 cut(s) 60
XbaI TCTAGA 1 cut(s) 119
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.