Rh5DG378800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
57644320 .. 57645864
1545 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG378800.1

Sequence Viewer

Length: 243 bp
ATGGTTACCGCTCACAGGTCTTCCTTCAACCTCCAGTTATCTACTGTCAAGTGTTCCCTCAGTGAAGGAGCAGCAGCAGACAACTTCCCTTCAAACGATTATGAACAATTGGAGGTGAATTCGGCTGAAATGAGTGCAAAACTTGCAAAGCTTGGCTTGGCAGCTAAAAGTACTGGAAAGAATCCTGCTGCCAATATCAAGGCCCTTATAGGGATTGTTCACCTGATGTGGGATGGGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.46

Weight (kDa)

7.9

Isoelectric Point (pI)

28.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 11
AciI CCGC 1 cut(s) 9
AcsI RAATTY 1 cut(s) 118
AfaI GTAC 1 cut(s) 172
AfiI CCNNNNNNNGG 3 cut(s) 15, 210, 229
AgsI TTSAA 2 cut(s) 28, 93
AluBI AGCT 2 cut(s) 151, 164
AluI AGCT 2 cut(s) 151, 164
AoxI GGCC 1 cut(s) 201
ApeKI GCWGC 4 cut(s) 71, 74, 161, 188
ApoI RAATTY 1 cut(s) 118
AspS9I GGNCC 1 cut(s) 202
AsuHPI GGTGA 2 cut(s) 127, 212
BbsI GAAGAC 1 cut(s) 12
BbvI GCAGC 4 cut(s) 83, 86, 173, 175
BccI CCATC 1 cut(s) 227
BisI GCNGC 4 cut(s) 72, 75, 162, 189
BlsI GCNGC 4 cut(s) 73, 76, 163, 190
BmcAI AGTACT 1 cut(s) 172
BmgT120I GGNCC 1 cut(s) 202
BpiI GAAGAC 1 cut(s) 12
BpmI CTGGAG 1 cut(s) 17
Bsc4I CCNNNNNNNGG 3 cut(s) 15, 210, 229
Bse1I ACTGG 2 cut(s) 34, 178
BseGI GGATG 1 cut(s) 238
BseLI CCNNNNNNNGG 3 cut(s) 15, 210, 229
BseMII CTCAG 1 cut(s) 73
BseNI ACTGG 2 cut(s) 34, 178
BseXI GCAGC 4 cut(s) 83, 86, 173, 175
BshFI GGCC 1 cut(s) 203
BslI CCNNNNNNNGG 3 cut(s) 15, 210, 229
BsnI GGCC 1 cut(s) 203
BspACI CCGC 1 cut(s) 9
BspANI GGCC 1 cut(s) 203
BspCNI CTCAG 1 cut(s) 72
BsrBI CCGCTC 1 cut(s) 11
BsrI ACTGG 2 cut(s) 34, 178
Bst4CI ACNGT 1 cut(s) 46
BstAPI GCANNNNNTGC 1 cut(s) 143
BstDEI CTNAG 1 cut(s) 59
BstEII GGTNACC 1 cut(s) 4
BstF5I GGATG 1 cut(s) 238
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstPI GGTNACC 1 cut(s) 4
BstV1I GCAGC 4 cut(s) 83, 86, 173, 175
BstV2I GAAGAC 1 cut(s) 12
BsuRI GGCC 1 cut(s) 203
BtsCI GGATG 1 cut(s) 238
BtsIMutI CAGTG 1 cut(s) 67
Cfr13I GGNCC 1 cut(s) 202
Csp6I GTAC 1 cut(s) 171
CviJI RGCY 5 cut(s) 125, 151, 156, 164, 203
CviKI_1 RGCY 5 cut(s) 125, 151, 156, 164, 203
CviQI GTAC 1 cut(s) 171
DdeI CTNAG 1 cut(s) 59
Eco91I GGTNACC 1 cut(s) 4
EcoO109I RGGNCCY 1 cut(s) 202
EcoO65I GGTNACC 1 cut(s) 4
EcoRI GAATTC 1 cut(s) 118
FaiI YATR 2 cut(s) 102, 209
FalI AAGNNNNNCTT 2 cut(s) 140, 172
Fnu4HI GCNGC 4 cut(s) 72, 75, 162, 189
Fsp4HI GCNGC 4 cut(s) 72, 75, 162, 189
GluI GCNGC 4 cut(s) 72, 75, 162, 189
GsuI CTGGAG 1 cut(s) 17
HaeIII GGCC 1 cut(s) 203
HindIII AAGCTT 1 cut(s) 149
HinfI GANTC 1 cut(s) 181
HphI GGTGA 2 cut(s) 127, 212
Hpy166II GTNNAC 1 cut(s) 220
Hpy8I GTNNAC 1 cut(s) 220
HpyAV CCTTC 3 cut(s) 34, 59, 99
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 137, 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 1 cut(s) 59
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 4 cut(s) 47, 159, 198, 236
Lsp1109I GCAGC 4 cut(s) 83, 86, 173, 175
MaeIII GTNAC 1 cut(s) 4
MbiI CCGCTC 1 cut(s) 11
MboII GAAGA 1 cut(s) 12
MfeI CAATTG 1 cut(s) 107
MluCI AATT 2 cut(s) 107, 118
MnlI CCTC 3 cut(s) 41, 68, 106
MunI CAATTG 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 143
PfeI GAWTC 1 cut(s) 181
PkrI GCNGC 4 cut(s) 73, 76, 163, 190
PspEI GGTNACC 1 cut(s) 4
PspPI GGNCC 1 cut(s) 202
RsaI GTAC 1 cut(s) 172
RsaNI GTAC 1 cut(s) 171
SatI GCNGC 4 cut(s) 72, 75, 162, 189
Sau96I GGNCC 1 cut(s) 202
ScaI AGTACT 1 cut(s) 172
SetI ASST 6 cut(s) 20, 33, 117, 153, 166, 225
Sse9I AATT 2 cut(s) 107, 118
SsiI CCGC 1 cut(s) 9
TaaI ACNGT 1 cut(s) 46
TasI AATT 2 cut(s) 107, 118
TatI WGTACW 1 cut(s) 170
TfiI GAWTC 1 cut(s) 181
TscAI CASTG 1 cut(s) 67
TseI GCWGC 4 cut(s) 71, 74, 161, 188
TspDTI ATGAA 1 cut(s) 117
TspRI CASTG 1 cut(s) 67
XapI RAATTY 1 cut(s) 118
ZrmI AGTACT 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.