Prupe.6G283000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
26368650 .. 26369352
703 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G283000.1

Sequence Viewer

Length: 324 bp
ATGGGGGAAGCTTCTGGAAAAATCGATCTTGAGAAGCTGATTTTGTACAGCGACGATCTGGTGGGTTTTTTGAAGGACAAGAAGGACCTGAACAACTTGGAGCATTCTCTCCAACATTCCAAGGCCCTCCGCTCCTCATGTGATGCCGATTTCAACGAAGTTCAGAATTTGCTTCAAGACTATGAGAAAAAGGTAGATGCATGCAAGCAGAAAACTGAGGTGGCATATTCAGAGGTTGTTGCTGATGAAGAAATAGACCTTCTTCAAAGAGAACTTGATGGAGTCATTGAAACAGAAAGTTTGTTTATGGAGGAGTTAAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.24

Weight (kDa)

4.41

Isoelectric Point (pI)

51.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 132
AciI CCGC 1 cut(s) 130
AcsI RAATTY 1 cut(s) 166
AfaI GTAC 1 cut(s) 47
AgsI TTSAA 5 cut(s) 73, 154, 176, 266, 290
AluBI AGCT 2 cut(s) 11, 37
AluI AGCT 2 cut(s) 11, 37
AoxI GGCC 1 cut(s) 123
ApoI RAATTY 1 cut(s) 166
AspS9I GGNCC 2 cut(s) 85, 124
AvaII GGWCC 1 cut(s) 85
BccI CCATC 1 cut(s) 272
Bme18I GGWCC 1 cut(s) 85
BmgT120I GGNCC 2 cut(s) 85, 124
BmsI GCATC 2 cut(s) 133, 187
BpuEI CTTGAG 1 cut(s) 50
Bsa29I ATCGAT 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 120
BseCI ATCGAT 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 207
BseRI GAGGAG 1 cut(s) 124
BshFI GGCC 1 cut(s) 125
BshVI ATCGAT 1 cut(s) 24
BsmI GAATGC 1 cut(s) 103
BsnI GGCC 1 cut(s) 125
Bsp1407I TGTACA 1 cut(s) 45
Bsp143I GATC 2 cut(s) 25, 55
BspACI CCGC 1 cut(s) 130
BspANI GGCC 1 cut(s) 125
BspCNI CTCAG 1 cut(s) 208
BspDI ATCGAT 1 cut(s) 24
BsrBI CCGCTC 1 cut(s) 132
BsrGI TGTACA 1 cut(s) 45
BssECI CCNNGG 1 cut(s) 120
BssMI GATC 2 cut(s) 25, 55
BssT1I CCWWGG 1 cut(s) 120
BstAUI TGTACA 1 cut(s) 45
BstC8I GCNNGC 2 cut(s) 202, 206
BstDEI CTNAG 1 cut(s) 216
BstKTI GATC 2 cut(s) 28, 58
BstMBI GATC 2 cut(s) 25, 55
BstNSI RCATGY 1 cut(s) 204
Bsu15I ATCGAT 1 cut(s) 24
BsuRI GGCC 1 cut(s) 125
BsuTUI ATCGAT 1 cut(s) 24
Cac8I GCNNGC 2 cut(s) 202, 206
Cfr13I GGNCC 2 cut(s) 85, 124
ClaI ATCGAT 1 cut(s) 24
Csp6I GTAC 1 cut(s) 46
CviAII CATG 2 cut(s) 138, 201
CviJI RGCY 3 cut(s) 11, 37, 125
CviKI_1 RGCY 3 cut(s) 11, 37, 125
CviQI GTAC 1 cut(s) 46
DdeI CTNAG 1 cut(s) 216
DpnI GATC 2 cut(s) 27, 57
DpnII GATC 2 cut(s) 25, 55
Eco130I CCWWGG 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 85
EcoO109I RGGNCCY 2 cut(s) 85, 124
EcoT14I CCWWGG 1 cut(s) 120
EcoT22I ATGCAT 1 cut(s) 202
ErhI CCWWGG 1 cut(s) 120
FaeI CATG 2 cut(s) 141, 204
FaiI YATR 5 cut(s) 139, 183, 202, 226, 308
FatI CATG 2 cut(s) 137, 200
HaeIII GGCC 1 cut(s) 125
Hin1II CATG 2 cut(s) 141, 204
HindIII AAGCTT 1 cut(s) 9
HinfI GANTC 1 cut(s) 282
Hpy188I TCNGA 2 cut(s) 165, 232
Hpy188III TCNNGA 3 cut(s) 15, 29, 176
Hpy99I CGWCG 1 cut(s) 56
HpyAV CCTTC 3 cut(s) 67, 76, 269
HpyCH4V TGCA 2 cut(s) 200, 204
HpyF3I CTNAG 1 cut(s) 216
Hsp92II CATG 2 cut(s) 141, 204
Kzo9I GATC 2 cut(s) 25, 55
LmnI GCTCC 2 cut(s) 100, 137
LpnPI CCDG 2 cut(s) 44, 101
LweI GCATC 2 cut(s) 133, 187
MalI GATC 2 cut(s) 27, 57
MbiI CCGCTC 1 cut(s) 132
MboI GATC 2 cut(s) 25, 55
MboII GAAGA 2 cut(s) 254, 260
MluCI AATT 1 cut(s) 166
MlyI GAGTC 1 cut(s) 291
MmeI TCCRAC 1 cut(s) 136
MnlI CCTC 5 cut(s) 137, 145, 211, 226, 304
Mph1103I ATGCAT 1 cut(s) 202
MseI TTAA 1 cut(s) 317
Mva1269I GAATGC 1 cut(s) 103
NdeII GATC 2 cut(s) 25, 55
NlaIII CATG 2 cut(s) 141, 204
NsiI ATGCAT 1 cut(s) 202
NspI RCATGY 1 cut(s) 204
PaeI GCATGC 1 cut(s) 204
PctI GAATGC 1 cut(s) 103
PleI GAGTC 1 cut(s) 290
PpsI GAGTC 1 cut(s) 290
PpuMI RGGWCCY 1 cut(s) 85
Psp5II RGGWCCY 1 cut(s) 85
PspPI GGNCC 2 cut(s) 85, 124
PspPPI RGGWCCY 1 cut(s) 85
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
SaqAI TTAA 1 cut(s) 317
Sau3AI GATC 2 cut(s) 25, 55
Sau96I GGNCC 2 cut(s) 85, 124
SchI GAGTC 1 cut(s) 291
SetI ASST 7 cut(s) 13, 39, 90, 195, 222, 237, 261
SfaNI GCATC 2 cut(s) 133, 187
SinI GGWCC 1 cut(s) 85
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
SphI GCATGC 1 cut(s) 204
Sse9I AATT 1 cut(s) 166
SsiI CCGC 1 cut(s) 130
StyI CCWWGG 1 cut(s) 120
TaqI TCGA 1 cut(s) 24
TasI AATT 1 cut(s) 166
TatI WGTACW 1 cut(s) 45
Tru1I TTAA 1 cut(s) 317
Tru9I TTAA 1 cut(s) 317
TspDTI ATGAA 1 cut(s) 261
VpaK11BI GGWCC 1 cut(s) 85
XapI RAATTY 1 cut(s) 166
XceI RCATGY 1 cut(s) 204
Zsp2I ATGCAT 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.