Rh3BG116400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
9593832 .. 9594310
479 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG116400.1

Sequence Viewer

Length: 324 bp
ATGGCGGACGCTTCTGGAACACTCGACATCCAGTGGCTGATCTCCAACAGCGACGACCTTGTGCGGGTCTTGAAGGACACCAAAGACCTCAACCACTTGACCCACTGCCTCCAAAACTCCCAAACCCTCCGCTCCTCCTCCGATTCCGATTTCGCCGAAGCTCACAACTTGCTCCGAGATTATGAGAAGAAGTTAGATGCTTGCAAGAAGAAAACCGAGGAGGCGAAAACCGAGGCGGTTGCTGATGAGGAATTGGAGCTTCTTCAGAGAGAATTGGATGAGGGCGTTCGACAGGAGCATTTGCTTATGGAGGAGCTGAGATAA

Protein Analysis

107

Amino Acids

12.3

Weight (kDa)

4.68

Isoelectric Point (pI)

51.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 132
AciI CCGC 4 cut(s) 5, 64, 130, 236
AcuI CTGAAG 1 cut(s) 248
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 1 cut(s) 73
AluBI AGCT 3 cut(s) 161, 259, 316
AluI AGCT 3 cut(s) 161, 259, 316
AlwNI CAGNNNCTG 1 cut(s) 37
BcgI CGANNNNNNTGC 2 cut(s) 221, 255
BmsI GCATC 1 cut(s) 187
BsaJI CCNNGG 2 cut(s) 216, 231
Bsc4I CCNNNNNNNGG 1 cut(s) 64
Bse1I ACTGG 1 cut(s) 31
BseDI CCNNGG 2 cut(s) 216, 231
BseGI GGATG 2 cut(s) 27, 283
BseLI CCNNNNNNNGG 1 cut(s) 64
BseMII CTCAG 1 cut(s) 308
BseNI ACTGG 1 cut(s) 31
BseRI GAGGAG 3 cut(s) 124, 127, 233
BslI CCNNNNNNNGG 1 cut(s) 64
Bsp143I GATC 1 cut(s) 39
BspACI CCGC 4 cut(s) 5, 64, 130, 236
BspCNI CTCAG 1 cut(s) 309
BsrBI CCGCTC 1 cut(s) 132
BsrI ACTGG 1 cut(s) 31
BssECI CCNNGG 2 cut(s) 216, 231
BssMI GATC 1 cut(s) 39
BstC8I GCNNGC 1 cut(s) 202
BstDEI CTNAG 1 cut(s) 317
BstF5I GGATG 2 cut(s) 27, 283
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BtsCI GGATG 2 cut(s) 27, 283
BtsI GCAGTG 1 cut(s) 103
BtsIMutI CAGTG 2 cut(s) 38, 103
Cac8I GCNNGC 1 cut(s) 202
CaiI CAGNNNCTG 1 cut(s) 37
CseI GACGC 1 cut(s) 17
CviJI RGCY 4 cut(s) 37, 161, 259, 316
CviKI_1 RGCY 4 cut(s) 37, 161, 259, 316
DdeI CTNAG 1 cut(s) 317
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
EciI GGCGGA 1 cut(s) 20
Eco57I CTGAAG 1 cut(s) 248
FaiI YATR 2 cut(s) 183, 308
FauI CCCGC 1 cut(s) 57
FokI GGATG 2 cut(s) 14, 290
HgaI GACGC 1 cut(s) 17
HinfI GANTC 1 cut(s) 143
Hpy188I TCNGA 4 cut(s) 142, 148, 176, 267
Hpy188III TCNNGA 2 cut(s) 15, 70
Hpy99I CGWCG 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 67
HpyCH4V TGCA 1 cut(s) 204
HpyF3I CTNAG 1 cut(s) 317
Kzo9I GATC 1 cut(s) 39
LmnI GCTCC 5 cut(s) 137, 177, 256, 295, 313
LpnPI CCDG 2 cut(s) 44, 278
LweI GCATC 1 cut(s) 187
MalI GATC 1 cut(s) 41
MbiI CCGCTC 1 cut(s) 132
MboI GATC 1 cut(s) 39
MboII GAAGA 3 cut(s) 199, 220, 254
MluCI AATT 2 cut(s) 251, 272
MmeI TCCRAC 1 cut(s) 69
NdeII GATC 1 cut(s) 39
PfeI GAWTC 1 cut(s) 143
PstNI CAGNNNCTG 1 cut(s) 37
Sau3AI GATC 1 cut(s) 39
SetI ASST 5 cut(s) 60, 90, 163, 261, 318
SfaNI GCATC 1 cut(s) 187
Sse9I AATT 2 cut(s) 251, 272
SsiI CCGC 4 cut(s) 5, 64, 130, 236
TaqI TCGA 2 cut(s) 24, 289
TasI AATT 2 cut(s) 251, 272
TfiI GAWTC 1 cut(s) 143
TscAI CASTG 2 cut(s) 38, 110
TspRI CASTG 2 cut(s) 38, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.