Prupe.7G092100_v2.0.a1
ERF Family

Phosphatidylglycerol phosphatidylinositol transfer

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0009073
Physical Location & Seq
Reverse (-)
12490255 .. 12492891
2637 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G092100.1

Sequence Viewer

Length: 468 bp
ATGGCTCAGTTCAAGCTGATCGCTTCCCTACTTGTATCTCTATGTCTCGTTCTACCTCTCATCCAAGCCAAAGATGTTAACTACTGCGATAAGAAGGCTGACTATGATGTCAAGGTCAAGGCAGTCGAGATAATTCCTTACCCTGTGGCGAGAGGCAAGCCTGCCAGCTTCAGCATTTCTGCAACTACAGGTGAATCAATCTCTGGAGGAAAATTGGTGATTGAGGTTTCATACTTTGGTTGGCACATCCACAGTGAGACTCATGACCTTTGCTCAGAAACATCTTGCCCTGTTTCAACTGGTGATTTCGTGATTGCTCACTCGCAAGATTTGCCTGGATATACTCCACCTGGTTCATACTCTCTTAAAATGAGGTTGTACGACGGAAACAAACATGAACTGACATGCATTGCCTTTGATTTTGACATCGGGTTTGCATCATCCGATTCATCCGTGGCTGATAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
E1_DerP2_DerF2

Protein Analysis

156

Amino Acids

16.76

Weight (kDa)

5.2

Isoelectric Point (pI)

41.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 107
AcuI CTGAAG 1 cut(s) 154
AfaI GTAC 1 cut(s) 380
AgsI TTSAA 2 cut(s) 13, 297
AjnI CCWGG 2 cut(s) 334, 349
AluBI AGCT 2 cut(s) 16, 168
AluI AGCT 2 cut(s) 16, 168
Alw26I GTCTC 2 cut(s) 50, 251
ArsI GACNNNNNNTTYG 2 cut(s) 416, 448
AsuHPI GGTGA 3 cut(s) 203, 229, 314
BciT130I CCWGG 2 cut(s) 336, 351
BcoDI GTCTC 2 cut(s) 50, 251
BfmI CTRYAG 1 cut(s) 186
Bme1390I CCNGG 2 cut(s) 336, 351
BmrFI CCNGG 2 cut(s) 336, 351
BmsI GCATC 1 cut(s) 446
BpmI CTGGAG 1 cut(s) 225
BsaJI CCNNGG 1 cut(s) 453
Bse1I ACTGG 1 cut(s) 304
Bse3DI GCAATG 1 cut(s) 408
BseBI CCWGG 2 cut(s) 336, 351
BseDI CCNNGG 1 cut(s) 453
BseGI GGATG 4 cut(s) 60, 246, 440, 449
BseMI GCAATG 1 cut(s) 408
BseMII CTCAG 2 cut(s) 20, 288
BseNI ACTGG 1 cut(s) 304
BsmAI GTCTC 2 cut(s) 50, 251
Bsp143I GATC 1 cut(s) 18
BspCNI CTCAG 2 cut(s) 19, 287
BspHI TCATGA 1 cut(s) 262
BsrDI GCAATG 1 cut(s) 408
BsrI ACTGG 1 cut(s) 304
BssECI CCNNGG 1 cut(s) 453
BssMI GATC 1 cut(s) 18
Bst2UI CCWGG 2 cut(s) 336, 351
Bst4CI ACNGT 1 cut(s) 254
BstAPI GCANNNNNTGC 1 cut(s) 331
BstC8I GCNNGC 3 cut(s) 158, 162, 166
BstDEI CTNAG 2 cut(s) 6, 274
BstDSI CCRYGG 1 cut(s) 453
BstF5I GGATG 4 cut(s) 60, 246, 440, 449
BstKTI GATC 1 cut(s) 21
BstMAI GTCTC 2 cut(s) 50, 251
BstMBI GATC 1 cut(s) 18
BstMWI GCNNNNNNNGC 1 cut(s) 331
BstNI CCWGG 2 cut(s) 336, 351
BstNSI RCATGY 1 cut(s) 408
BstSCI CCNGG 2 cut(s) 334, 349
BstSFI CTRYAG 1 cut(s) 186
BtgI CCRYGG 1 cut(s) 453
BtsCI GGATG 4 cut(s) 60, 246, 440, 449
BtsIMutI CAGTG 1 cut(s) 259
Cac8I GCNNGC 3 cut(s) 158, 162, 166
CciI TCATGA 1 cut(s) 262
CsiI ACCWGGT 1 cut(s) 349
Csp6I GTAC 1 cut(s) 379
CviAII CATG 3 cut(s) 263, 395, 405
CviJI RGCY 7 cut(s) 5, 16, 68, 98, 160, 168, 458
CviKI_1 RGCY 7 cut(s) 5, 16, 68, 98, 160, 168, 458
CviQI GTAC 1 cut(s) 379
DdeI CTNAG 2 cut(s) 6, 274
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
DrdI GACNNNNNNGTC 1 cut(s) 107
DseDI GACNNNNNNGTC 1 cut(s) 107
Eco57I CTGAAG 1 cut(s) 154
EcoRII CCWGG 2 cut(s) 334, 349
EcoT22I ATGCAT 1 cut(s) 410
FaeI CATG 3 cut(s) 266, 398, 408
FaiI YATR 8 cut(s) 43, 105, 232, 264, 342, 358, 396, 406
FatI CATG 3 cut(s) 262, 394, 404
FokI GGATG 4 cut(s) 47, 233, 427, 436
GsuI CTGGAG 1 cut(s) 225
Hin1II CATG 3 cut(s) 266, 398, 408
HincII GTYRAC 1 cut(s) 79
HindII GTYRAC 1 cut(s) 79
HinfI GANTC 3 cut(s) 194, 259, 446
HpaI GTTAAC 1 cut(s) 79
HphI GGTGA 3 cut(s) 203, 229, 314
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 2 cut(s) 277, 445
Hpy188III TCNNGA 4 cut(s) 127, 204, 263, 310
Hpy8I GTNNAC 1 cut(s) 79
Hpy99I CGWCG 1 cut(s) 386
HpyAV CCTTC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 254
HpyCH4V TGCA 3 cut(s) 182, 408, 437
HpyF10VI GCNNNNNNNGC 1 cut(s) 331
HpyF3I CTNAG 2 cut(s) 6, 274
Hsp92II CATG 3 cut(s) 266, 398, 408
KspAI GTTAAC 1 cut(s) 79
Kzo9I GATC 1 cut(s) 18
LweI GCATC 1 cut(s) 446
MabI ACCWGGT 1 cut(s) 349
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MluCI AATT 2 cut(s) 132, 212
MlyI GAGTC 1 cut(s) 253
MnlI CCTC 5 cut(s) 66, 146, 200, 217, 366
Mph1103I ATGCAT 1 cut(s) 410
MseI TTAA 3 cut(s) 78, 366, 466
MspR9I CCNGG 2 cut(s) 336, 351
MvaI CCWGG 2 cut(s) 336, 351
MwoI GCNNNNNNNGC 1 cut(s) 331
NdeII GATC 1 cut(s) 18
NlaIII CATG 3 cut(s) 266, 398, 408
NsiI ATGCAT 1 cut(s) 410
NspI RCATGY 1 cut(s) 408
PagI TCATGA 1 cut(s) 262
PfeI GAWTC 2 cut(s) 194, 446
PleI GAGTC 1 cut(s) 253
PpsI GAGTC 1 cut(s) 253
Psp6I CCWGG 2 cut(s) 334, 349
PspGI CCWGG 2 cut(s) 334, 349
RsaI GTAC 1 cut(s) 380
RsaNI GTAC 1 cut(s) 379
SaqAI TTAA 3 cut(s) 78, 366, 466
Sau3AI GATC 1 cut(s) 18
SchI GAGTC 1 cut(s) 253
ScrFI CCNGG 2 cut(s) 336, 351
SetI ASST 9 cut(s) 18, 58, 117, 170, 193, 228, 270, 352, 377
SexAI ACCWGGT 1 cut(s) 349
SfaNI GCATC 1 cut(s) 446
SfcI CTRYAG 1 cut(s) 186
Sse9I AATT 2 cut(s) 132, 212
StyD4I CCNGG 2 cut(s) 334, 349
TaaI ACNGT 1 cut(s) 254
TaqI TCGA 1 cut(s) 126
TasI AATT 2 cut(s) 132, 212
TfiI GAWTC 2 cut(s) 194, 446
Tru1I TTAA 3 cut(s) 78, 366, 466
Tru9I TTAA 3 cut(s) 78, 366, 466
TscAI CASTG 1 cut(s) 259
TspDTI ATGAA 4 cut(s) 219, 345, 411, 438
TspGWI ACGGA 2 cut(s) 399, 442
TspRI CASTG 1 cut(s) 259
XceI RCATGY 1 cut(s) 408
Zsp2I ATGCAT 1 cut(s) 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.