Rmu_co8102346.1_g000001
ERF Family

Phosphatidylglycerol phosphatidylinositol transfer

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8102346.1
Physical Location & Seq
Forward (+)
1 .. 432
432 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8102346.1_g000001.1.cds

Sequence Viewer

Length: 301 bp
aagcgaatttctgctgatatgttcagataagaatgctgactatgctgtcaaggttacgggactcgacataaacccttaccccatcgccagaggcaagcctgccagcttcaacattgctgcaactacaggtgaatcaatcaccggagggaaattggtgattgatgtttcctactttgggtggcacatccacagtgagaatcatgacctttgctcggaaacatcttgccctgtttcagttggtgatttcgtggtcgcccactcacaagaattacctggatatactccacctgtaagtccttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

10.55

Weight (kDa)

4.85

Isoelectric Point (pI)

43.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 45
AcsI RAATTY 1 cut(s) 6
AfiI CCNNNNNNNGG 2 cut(s) 175, 212
AgsI TTSAA 1 cut(s) 110
AjnI CCWGG 1 cut(s) 272
AluBI AGCT 1 cut(s) 106
AluI AGCT 1 cut(s) 106
ApeKI GCWGC 1 cut(s) 117
ApoI RAATTY 1 cut(s) 6
AsuHPI GGTGA 4 cut(s) 131, 141, 167, 252
BbvI GCAGC 1 cut(s) 104
BccI CCATC 1 cut(s) 90
BciT130I CCWGG 1 cut(s) 274
BfmI CTRYAG 1 cut(s) 124
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 274
BmrFI CCNGG 1 cut(s) 274
BsaWI WCCGGW 1 cut(s) 141
Bsc4I CCNNNNNNNGG 2 cut(s) 175, 212
Bse3DI GCAATG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 274
BseGI GGATG 1 cut(s) 184
BseLI CCNNNNNNNGG 2 cut(s) 175, 212
BseMI GCAATG 1 cut(s) 112
BseXI GCAGC 1 cut(s) 104
BsiSI CCGG 1 cut(s) 142
BslFI GGGAC 1 cut(s) 73
BslI CCNNNNNNNGG 2 cut(s) 175, 212
BsmFI GGGAC 1 cut(s) 73
BsmI GAATGC 1 cut(s) 38
BspHI TCATGA 1 cut(s) 200
BsrDI GCAATG 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 274
Bst4CI ACNGT 1 cut(s) 192
BstC8I GCNNGC 3 cut(s) 96, 100, 104
BstF5I GGATG 1 cut(s) 184
BstMWI GCNNNNNNNGC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 274
BstSCI CCNGG 1 cut(s) 272
BstSFI CTRYAG 1 cut(s) 124
BstV1I GCAGC 1 cut(s) 104
BtgZI GCGATG 1 cut(s) 68
BtsCI GGATG 1 cut(s) 184
BtsIMutI CAGTG 1 cut(s) 197
Cac8I GCNNGC 3 cut(s) 96, 100, 104
CciI TCATGA 1 cut(s) 200
CviAII CATG 1 cut(s) 201
CviJI RGCY 2 cut(s) 98, 106
CviKI_1 RGCY 2 cut(s) 98, 106
DrdI GACNNNNNNGTC 1 cut(s) 45
DseDI GACNNNNNNGTC 1 cut(s) 45
EcoRII CCWGG 1 cut(s) 272
FaeI CATG 1 cut(s) 204
FaiI YATR 5 cut(s) 20, 43, 69, 202, 280
FaqI GGGAC 1 cut(s) 73
FatI CATG 1 cut(s) 200
Fnu4HI GCNGC 1 cut(s) 118
FokI GGATG 1 cut(s) 171
Fsp4HI GCNGC 1 cut(s) 118
GluI GCNGC 1 cut(s) 118
HapII CCGG 1 cut(s) 142
Hin1II CATG 1 cut(s) 204
HinfI GANTC 3 cut(s) 61, 132, 197
HpaII CCGG 1 cut(s) 142
HphI GGTGA 4 cut(s) 131, 141, 167, 252
Hpy188I TCNGA 2 cut(s) 26, 215
Hpy188III TCNNGA 1 cut(s) 201
HpyCH4III ACNGT 1 cut(s) 192
HpyCH4V TGCA 1 cut(s) 120
HpyF10VI GCNNNNNNNGC 1 cut(s) 42
Hsp92II CATG 1 cut(s) 204
LpnPI CCDG 8 cut(s) 101, 112, 112, 116, 155, 241, 259, 286
Lsp1109I GCAGC 1 cut(s) 104
MaeIII GTNAC 1 cut(s) 53
MluCI AATT 3 cut(s) 6, 150, 267
MlyI GAGTC 1 cut(s) 55
MnlI CCTC 2 cut(s) 84, 138
MseI TTAA 1 cut(s) 299
MspI CCGG 1 cut(s) 142
MspR9I CCNGG 1 cut(s) 274
Mva1269I GAATGC 1 cut(s) 38
MvaI CCWGG 1 cut(s) 274
MwoI GCNNNNNNNGC 1 cut(s) 42
NlaIII CATG 1 cut(s) 204
PagI TCATGA 1 cut(s) 200
PctI GAATGC 1 cut(s) 38
PfeI GAWTC 2 cut(s) 132, 197
PkrI GCNGC 1 cut(s) 119
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
Psp6I CCWGG 1 cut(s) 272
PspGI CCWGG 1 cut(s) 272
SaqAI TTAA 1 cut(s) 299
SatI GCNGC 1 cut(s) 118
SchI GAGTC 1 cut(s) 55
ScrFI CCNGG 1 cut(s) 274
SetI ASST 6 cut(s) 55, 108, 131, 208, 275, 290
SfcI CTRYAG 1 cut(s) 124
Sse9I AATT 3 cut(s) 6, 150, 267
StyD4I CCNGG 1 cut(s) 272
TaaI ACNGT 1 cut(s) 192
TaqI TCGA 1 cut(s) 64
TasI AATT 3 cut(s) 6, 150, 267
TfiI GAWTC 2 cut(s) 132, 197
Tru1I TTAA 1 cut(s) 299
Tru9I TTAA 1 cut(s) 299
TscAI CASTG 1 cut(s) 197
TseI GCWGC 1 cut(s) 117
TspRI CASTG 1 cut(s) 197
XapI RAATTY 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.