Prupe.8G111400_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
14066415 .. 14067203
789 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G111400.1

Sequence Viewer

Length: 255 bp
ATGTCTGCAGTGGTGGAGGTTTGGATGAGCGAGTTGGCAAAGCTGAAAGACAAGGTAGGGGCTAAGAAGCGACTGGTGTTTTCATCAAAGGGAAAACAAGGAGAAGGTGATGATGAGGTTGAAGAACAACAGCAAGTGTTGAAAGAAGCAAGAAAAGAGAGCAGCAGAATGGTTCAGATTCAGAGGGACTTGGATTCCTCTAGTCTTTCAGAGGCCACAGTTCGTTTGCTTATGGACCGTTTTGTGCTTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.6

Weight (kDa)

6.29

Isoelectric Point (pI)

52.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 122, 142
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AoxI GGCC 1 cut(s) 213
ApeKI GCWGC 1 cut(s) 162
AspS9I GGNCC 1 cut(s) 235
AsuHPI GGTGA 1 cut(s) 119
AvaII GGWCC 1 cut(s) 235
BbvI GCAGC 1 cut(s) 174
BfaI CTAG 1 cut(s) 201
BfmI CTRYAG 1 cut(s) 6
BisI GCNGC 1 cut(s) 163
BlsI GCNGC 1 cut(s) 164
Bme18I GGWCC 1 cut(s) 235
BmgT120I GGNCC 1 cut(s) 235
Bse1I ACTGG 1 cut(s) 78
BseGI GGATG 1 cut(s) 30
BseNI ACTGG 1 cut(s) 78
BseXI GCAGC 1 cut(s) 174
BshFI GGCC 1 cut(s) 215
BslFI GGGAC 1 cut(s) 200
BsmFI GGGAC 1 cut(s) 200
BsnI GGCC 1 cut(s) 215
BspANI GGCC 1 cut(s) 215
BspMAI CTGCAG 1 cut(s) 10
BsrI ACTGG 1 cut(s) 78
Bst4CI ACNGT 2 cut(s) 220, 239
BstDEI CTNAG 1 cut(s) 63
BstF5I GGATG 1 cut(s) 30
BstSFI CTRYAG 1 cut(s) 6
BstV1I GCAGC 1 cut(s) 174
BsuRI GGCC 1 cut(s) 215
BtsCI GGATG 1 cut(s) 30
BtsI GCAGTG 1 cut(s) 15
BtsIMutI CAGTG 1 cut(s) 15
Cfr13I GGNCC 1 cut(s) 235
CviJI RGCY 3 cut(s) 43, 62, 215
CviKI_1 RGCY 3 cut(s) 43, 62, 215
DdeI CTNAG 1 cut(s) 63
Eco47I GGWCC 1 cut(s) 235
FaiI YATR 1 cut(s) 233
FaqI GGGAC 1 cut(s) 200
Fnu4HI GCNGC 1 cut(s) 163
FokI GGATG 1 cut(s) 37
Fsp4HI GCNGC 1 cut(s) 163
FspBI CTAG 1 cut(s) 201
GluI GCNGC 1 cut(s) 163
HaeIII GGCC 1 cut(s) 215
HinfI GANTC 2 cut(s) 178, 194
HphI GGTGA 1 cut(s) 119
Hpy188I TCNGA 3 cut(s) 177, 183, 211
HpyAV CCTTC 1 cut(s) 98
HpyCH4III ACNGT 2 cut(s) 220, 239
HpyCH4V TGCA 1 cut(s) 8
HpyF3I CTNAG 1 cut(s) 63
LpnPI CCDG 1 cut(s) 59
Lsp1109I GCAGC 1 cut(s) 174
MaeI CTAG 1 cut(s) 201
MboII GAAGA 1 cut(s) 134
MnlI CCTC 5 cut(s) 10, 109, 177, 205, 208
PfeI GAWTC 2 cut(s) 178, 194
PkrI GCNGC 1 cut(s) 164
PspPI GGNCC 1 cut(s) 235
PstI CTGCAG 1 cut(s) 10
SatI GCNGC 1 cut(s) 163
Sau96I GGNCC 1 cut(s) 235
SetI ASST 5 cut(s) 21, 45, 57, 109, 120
SfcI CTRYAG 1 cut(s) 6
SgeI CNNG 8 cut(s) 43, 64, 86, 110, 146, 162, 202, 213
SinI GGWCC 1 cut(s) 235
SspMI CTAG 1 cut(s) 201
TaaI ACNGT 2 cut(s) 220, 239
TfiI GAWTC 2 cut(s) 178, 194
TscAI CASTG 1 cut(s) 15
TseI GCWGC 1 cut(s) 162
TspDTI ATGAA 1 cut(s) 72
TspRI CASTG 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 235
XspI CTAG 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.