Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0007455

Physical Location & Seq

Genomic Coordinates Forward (+)

15755843 .. 15756603

Gene Structure 761 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ23391

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

ATGTCTGCGGTGGTGGAGGTATGGGTGAGCGAGCTGGGGAAGCTGAAGGAGAAGGTTGGGGCCAAGAAGCGGTTTCTGTGGTCATCGAAGAAGGTGAAACATGCTGAAGGAGGAGATGAGGGTGAGGTTGATCAGCAACAACAACCAGCTGTAGCTGCTGCAGCTCATGAAGGTGCGGTGATGGAGACTACGGTTAGAAAAGAGAGGAGGAACTCTTCTACGCTTTCTGAGGCCACTGTTTGTATGCTCATGGACCGTTTTGTTCCTTGGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

90

Amino Acids

9.99

Weight (kDa)

7.89

Isoelectric Point (pI)

41.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007455)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G15960
fragaria_vesca	FvH4_2g07390
prunus_persica	Prupe.8G110900_v2.0.a1 Prupe.8G111400_v2.0.a1 Prupe.8G111600_v2.0.a1 Prupe.8G111800_v2.0.a1 Prupe.8G112000_v2.0.a1 Prupe.8G112200_v2.0.a1
pyrus_communis	pycom10g06800 pycom15g38220
rosa_chinensis	RchiOBHm_Chr5g0033931 RchiOBHm_Chr6g0260831
rosa_laevigata	RLG00000014482
rosa_multiflora	Rmu_sc0007732.1_g000002 Rmu_sc0014629.1_g000002 Rmu_sc0029234.1_g000001
rosa_roxburghii	Rroxscaffold_7G00207410
rosa_rugosa	Rorug02G0325000 Rorug05G0593100
rosa_samantha	Rh6AG112400 Rh6BG106300 Rh6CG103200 Rh6DG094400
rosa_wichuraiana	Rw6G009540 Rw6G009570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	8, 70, 176
AcuI	CTGAAG	2 cut(s)	65, 126
AfiI	CCNNNNNNNGG	1 cut(s)	69
AluBI	AGCT	5 cut(s)	34, 43, 149, 155, 164
AluI	AGCT	5 cut(s)	34, 43, 149, 155, 164
Alw26I	GTCTC	1 cut(s)	179
AoxI	GGCC	2 cut(s)	60, 231
ApeKI	GCWGC	3 cut(s)	155, 158, 161
AspS9I	GGNCC	2 cut(s)	60, 253
AsuHPI	GGTGA	4 cut(s)	37, 106, 134, 190
AvaII	GGWCC	1 cut(s)	253
BbvI	GCAGC	3 cut(s)	142, 145, 173
BccI	CCATC	1 cut(s)	175
BclI	TGATCA	1 cut(s)	130
BcoDI	GTCTC	1 cut(s)	179
BfmI	CTRYAG	2 cut(s)	150, 159
BisI	GCNGC	3 cut(s)	156, 159, 162
BlsI	GCNGC	3 cut(s)	157, 160, 163
Bme18I	GGWCC	1 cut(s)	253
BmgT120I	GGNCC	2 cut(s)	60, 253
BmiI	GGNNCC	1 cut(s)	61
BsaJI	CCNNGG	1 cut(s)	266
Bsc4I	CCNNNNNNNGG	1 cut(s)	69
BseDI	CCNNGG	1 cut(s)	266
BseLI	CCNNNNNNNGG	1 cut(s)	69
BseMII	CTCAG	1 cut(s)	219
BseRI	GAGGAG	2 cut(s)	126, 220
BseXI	GCAGC	3 cut(s)	142, 145, 173
BseYI	CCCAGC	1 cut(s)	34
BshFI	GGCC	2 cut(s)	62, 233
BslI	CCNNNNNNNGG	1 cut(s)	69
BsmAI	GTCTC	1 cut(s)	179
BsnI	GGCC	2 cut(s)	62, 233
Bsp143I	GATC	1 cut(s)	130
BspACI	CCGC	3 cut(s)	8, 70, 176
BspANI	GGCC	2 cut(s)	62, 233
BspCNI	CTCAG	1 cut(s)	220
BspHI	TCATGA	1 cut(s)	166
BspLI	GGNNCC	1 cut(s)	61
BspMAI	CTGCAG	1 cut(s)	163
BssECI	CCNNGG	1 cut(s)	266
BssMI	GATC	1 cut(s)	130
BssT1I	CCWWGG	1 cut(s)	266
Bst4CI	ACNGT	3 cut(s)	193, 238, 257
Bst6I	CTCTTC	1 cut(s)	220
BstC8I	GCNNGC	1 cut(s)	32
BstDEI	CTNAG	1 cut(s)	228
BstKTI	GATC	1 cut(s)	133
BstMAI	GTCTC	1 cut(s)	179
BstMBI	GATC	1 cut(s)	130
BstMWI	GCNNNNNNNGC	3 cut(s)	40, 155, 161
BstNSI	RCATGY	1 cut(s)	104
BstSFI	CTRYAG	2 cut(s)	150, 159
BstV1I	GCAGC	3 cut(s)	142, 145, 173
BsuRI	GGCC	2 cut(s)	62, 233
BtsIMutI	CAGTG	1 cut(s)	234
Cac8I	GCNNGC	1 cut(s)	32
CciI	TCATGA	1 cut(s)	166
Cfr13I	GGNCC	2 cut(s)	60, 253
CviAII	CATG	3 cut(s)	101, 167, 250
CviJI	RGCY	7 cut(s)	34, 43, 62, 149, 155, 164, 233
CviKI_1	RGCY	7 cut(s)	34, 43, 62, 149, 155, 164, 233
DdeI	CTNAG	1 cut(s)	228
DpnI	GATC	1 cut(s)	132
DpnII	GATC	1 cut(s)	130
Eam1104I	CTCTTC	1 cut(s)	220
EarI	CTCTTC	1 cut(s)	220
Eco130I	CCWWGG	1 cut(s)	266
Eco47I	GGWCC	1 cut(s)	253
Eco57I	CTGAAG	2 cut(s)	65, 126
EcoT14I	CCWWGG	1 cut(s)	266
ErhI	CCWWGG	1 cut(s)	266
FaeI	CATG	3 cut(s)	104, 170, 253
FaiI	YATR	5 cut(s)	22, 102, 168, 245, 251
FatI	CATG	3 cut(s)	100, 166, 249
FbaI	TGATCA	1 cut(s)	130
Fnu4HI	GCNGC	3 cut(s)	156, 159, 162
Fsp4HI	GCNGC	3 cut(s)	156, 159, 162
GluI	GCNGC	3 cut(s)	156, 159, 162
GsaI	CCCAGC	1 cut(s)	38
HaeIII	GGCC	2 cut(s)	62, 233
Hin1II	CATG	3 cut(s)	104, 170, 253
HphI	GGTGA	4 cut(s)	37, 106, 134, 190
Hpy188I	TCNGA	1 cut(s)	229
Hpy188III	TCNNGA	1 cut(s)	167
HpyAV	CCTTC	5 cut(s)	40, 46, 85, 101, 164
HpyCH4III	ACNGT	3 cut(s)	193, 238, 257
HpyCH4V	TGCA	1 cut(s)	161
HpyF10VI	GCNNNNNNNGC	3 cut(s)	40, 155, 161
HpyF3I	CTNAG	1 cut(s)	228
Hsp92II	CATG	3 cut(s)	104, 170, 253
Ksp22I	TGATCA	1 cut(s)	130
Kzo9I	GATC	1 cut(s)	130
LpnPI	CCDG	2 cut(s)	20, 159
Lsp1109I	GCAGC	3 cut(s)	142, 145, 173
MalI	GATC	1 cut(s)	132
MboI	GATC	1 cut(s)	130
MboII	GAAGA	2 cut(s)	100, 207
MnlI	CCTC	7 cut(s)	10, 104, 112, 118, 198, 201, 223
MslI	CAYNNNNRTG	1 cut(s)	171
MspA1I	CMGCKG	1 cut(s)	149
MwoI	GCNNNNNNNGC	3 cut(s)	40, 155, 161
NdeII	GATC	1 cut(s)	130
NlaIII	CATG	3 cut(s)	104, 170, 253
NlaIV	GGNNCC	1 cut(s)	61
NspI	RCATGY	1 cut(s)	104
PagI	TCATGA	1 cut(s)	166
PkrI	GCNGC	3 cut(s)	157, 160, 163
PspFI	CCCAGC	1 cut(s)	34
PspN4I	GGNNCC	1 cut(s)	61
PspPI	GGNCC	2 cut(s)	60, 253
PstI	CTGCAG	1 cut(s)	163
PvuII	CAGCTG	1 cut(s)	149
RseI	CAYNNNNRTG	1 cut(s)	171
SatI	GCNGC	3 cut(s)	156, 159, 162
Sau3AI	GATC	1 cut(s)	130
Sau96I	GGNCC	2 cut(s)	60, 253
SfcI	CTRYAG	2 cut(s)	150, 159
SgeI	CNNG	7 cut(s)	43, 47, 76, 113, 158, 179, 262
SinI	GGWCC	1 cut(s)	253
SmiMI	CAYNNNNRTG	1 cut(s)	171
SsiI	CCGC	3 cut(s)	8, 70, 176
StyI	CCWWGG	1 cut(s)	266
TaaI	ACNGT	3 cut(s)	193, 238, 257
TaqI	TCGA	1 cut(s)	86
TscAI	CASTG	1 cut(s)	241
TseI	GCWGC	3 cut(s)	155, 158, 161
TspDTI	ATGAA	1 cut(s)	183
TspRI	CASTG	1 cut(s)	241
VpaK11BI	GGWCC	1 cut(s)	253
XceI	RCATGY	1 cut(s)	104

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.