Prupe.8G111600_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
14073667 .. 14075539
1873 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G111600.1

Sequence Viewer

Length: 252 bp
ATGTCTGCAGTGGTGGAGGTTTGGATGAGCGAGTTTGCAAAGCTGAAAGACAAGGTAGGAGCTAAGAAGCGAATGGTGTTTTCATCAAAGGGCAAACAAGGAGAGGGTGATGATGAGGTTGAAGAAGAACAAGTGTTGAAAGAAGCAAGAAAAGAGAGCAGCAGAATGGCTCAGATTCAGAGGGACTTGGATTCCTCTACGCTTTCAGAGGCCACAGTCTGTTTGCTTATGGACCGTTTTGTGCCTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.44

Weight (kDa)

5.18

Isoelectric Point (pI)

52.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 122, 139
AluBI AGCT 2 cut(s) 43, 62
AluI AGCT 2 cut(s) 43, 62
AoxI GGCC 1 cut(s) 210
ApeKI GCWGC 1 cut(s) 159
AspS9I GGNCC 1 cut(s) 232
AsuHPI GGTGA 1 cut(s) 119
AvaII GGWCC 1 cut(s) 232
BbvI GCAGC 1 cut(s) 171
BfmI CTRYAG 1 cut(s) 6
BisI GCNGC 1 cut(s) 160
BlsI GCNGC 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 232
BsaJI CCNNGG 1 cut(s) 245
BseDI CCNNGG 1 cut(s) 245
BseGI GGATG 1 cut(s) 30
BseMII CTCAG 1 cut(s) 185
BseXI GCAGC 1 cut(s) 171
BshFI GGCC 1 cut(s) 212
BslFI GGGAC 1 cut(s) 197
BsmFI GGGAC 1 cut(s) 197
BsnI GGCC 1 cut(s) 212
BspANI GGCC 1 cut(s) 212
BspCNI CTCAG 1 cut(s) 184
BspMAI CTGCAG 1 cut(s) 10
BssECI CCNNGG 1 cut(s) 245
BssT1I CCWWGG 1 cut(s) 245
Bst4CI ACNGT 2 cut(s) 217, 236
BstDEI CTNAG 2 cut(s) 63, 171
BstF5I GGATG 1 cut(s) 30
BstSFI CTRYAG 1 cut(s) 6
BstV1I GCAGC 1 cut(s) 171
BsuRI GGCC 1 cut(s) 212
BtsCI GGATG 1 cut(s) 30
BtsI GCAGTG 1 cut(s) 15
BtsIMutI CAGTG 1 cut(s) 15
Cfr13I GGNCC 1 cut(s) 232
CviJI RGCY 4 cut(s) 43, 62, 170, 212
CviKI_1 RGCY 4 cut(s) 43, 62, 170, 212
DdeI CTNAG 2 cut(s) 63, 171
Eco130I CCWWGG 1 cut(s) 245
Eco47I GGWCC 1 cut(s) 232
EcoT14I CCWWGG 1 cut(s) 245
ErhI CCWWGG 1 cut(s) 245
FaiI YATR 1 cut(s) 230
FaqI GGGAC 1 cut(s) 197
Fnu4HI GCNGC 1 cut(s) 160
FokI GGATG 1 cut(s) 37
Fsp4HI GCNGC 1 cut(s) 160
GluI GCNGC 1 cut(s) 160
HaeIII GGCC 1 cut(s) 212
HinfI GANTC 2 cut(s) 175, 191
HphI GGTGA 1 cut(s) 119
Hpy188I TCNGA 3 cut(s) 174, 180, 208
HpyCH4III ACNGT 2 cut(s) 217, 236
HpyCH4V TGCA 2 cut(s) 8, 38
HpyF3I CTNAG 2 cut(s) 63, 171
LmnI GCTCC 1 cut(s) 59
Lsp1109I GCAGC 1 cut(s) 171
MboII GAAGA 2 cut(s) 134, 137
MnlI CCTC 6 cut(s) 10, 97, 109, 174, 202, 205
PfeI GAWTC 2 cut(s) 175, 191
PkrI GCNGC 1 cut(s) 161
PspPI GGNCC 1 cut(s) 232
PstI CTGCAG 1 cut(s) 10
SatI GCNGC 1 cut(s) 160
Sau96I GGNCC 1 cut(s) 232
SetI ASST 5 cut(s) 21, 45, 57, 64, 120
SfcI CTRYAG 1 cut(s) 6
SgeI CNNG 6 cut(s) 43, 64, 110, 143, 159, 199
SinI GGWCC 1 cut(s) 232
StyI CCWWGG 1 cut(s) 245
TaaI ACNGT 2 cut(s) 217, 236
TfiI GAWTC 2 cut(s) 175, 191
TscAI CASTG 1 cut(s) 15
TseI GCWGC 1 cut(s) 159
TspDTI ATGAA 1 cut(s) 72
TspRI CASTG 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.