Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6B

Orthogroup ID

OG0007455

Physical Location & Seq

Genomic Coordinates Forward (+)

16451786 .. 16452214

Gene Structure 429 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6BG106300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 213 bp

ATGTCTGCAGTGGTGGAGGTATGGGTGAGCGAGCTGGGGAAGCTGAAGGAGAAGGTTGGGGCCAAGAAGCGGTTTCTGTGGTCGTCGAAGAAGGTGAAACATGCTGAAGGAGGAGATGAGGGTGAGGTTGATCAGCAACAACAACCAGCTGTAGCTGCTGCAGCTCATGAAGGTGCGGTGATGGAGACTACGTATCAAAATAAAGTTCGGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

70

Amino Acids

7.68

Weight (kDa)

8.03

Isoelectric Point (pI)

31.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007455)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G15960
fragaria_vesca	FvH4_2g07390
prunus_persica	Prupe.8G110900_v2.0.a1 Prupe.8G111400_v2.0.a1 Prupe.8G111600_v2.0.a1 Prupe.8G111800_v2.0.a1 Prupe.8G112000_v2.0.a1 Prupe.8G112200_v2.0.a1
pyrus_communis	pycom10g06800 pycom15g38220
rosa_chinensis	RchiOBHm_Chr5g0033931 RchiOBHm_Chr6g0260831
rosa_laevigata	RLG00000014482
rosa_multiflora	Rmu_sc0007732.1_g000002 Rmu_sc0014629.1_g000002 Rmu_sc0029234.1_g000001
rosa_roxburghii	Rroxscaffold_7G00207410
rosa_rugosa	Rorug02G0325000 Rorug05G0593100
rosa_samantha	Rh6AG112400 Rh6BG106300 Rh6CG103200 Rh6DG094400
rosa_wichuraiana	Rw6G009540 Rw6G009570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	70, 176
AcuI	CTGAAG	2 cut(s)	65, 126
AfiI	CCNNNNNNNGG	1 cut(s)	69
AluBI	AGCT	5 cut(s)	34, 43, 149, 155, 164
AluI	AGCT	5 cut(s)	34, 43, 149, 155, 164
Alw26I	GTCTC	1 cut(s)	179
AoxI	GGCC	1 cut(s)	60
ApeKI	GCWGC	3 cut(s)	155, 158, 161
AspS9I	GGNCC	1 cut(s)	60
AsuHPI	GGTGA	4 cut(s)	37, 106, 134, 190
BbvI	GCAGC	3 cut(s)	142, 145, 173
BccI	CCATC	1 cut(s)	175
BclI	TGATCA	1 cut(s)	130
BcoDI	GTCTC	1 cut(s)	179
BfmI	CTRYAG	3 cut(s)	6, 150, 159
BisI	GCNGC	3 cut(s)	156, 159, 162
BlsI	GCNGC	3 cut(s)	157, 160, 163
BmgT120I	GGNCC	1 cut(s)	60
BmiI	GGNNCC	1 cut(s)	61
BsaAI	YACGTR	1 cut(s)	192
BsaXI	ACNNNNNCTCC	2 cut(s)	176, 206
Bsc4I	CCNNNNNNNGG	1 cut(s)	69
BseLI	CCNNNNNNNGG	1 cut(s)	69
BseRI	GAGGAG	1 cut(s)	126
BseXI	GCAGC	3 cut(s)	142, 145, 173
BseYI	CCCAGC	1 cut(s)	34
BshFI	GGCC	1 cut(s)	62
BslI	CCNNNNNNNGG	1 cut(s)	69
BsmAI	GTCTC	1 cut(s)	179
BsnI	GGCC	1 cut(s)	62
Bsp143I	GATC	1 cut(s)	130
BspACI	CCGC	2 cut(s)	70, 176
BspANI	GGCC	1 cut(s)	62
BspHI	TCATGA	1 cut(s)	166
BspLI	GGNNCC	1 cut(s)	61
BspMAI	CTGCAG	2 cut(s)	10, 163
BssMI	GATC	1 cut(s)	130
BstBAI	YACGTR	1 cut(s)	192
BstC8I	GCNNGC	1 cut(s)	32
BstKTI	GATC	1 cut(s)	133
BstMAI	GTCTC	1 cut(s)	179
BstMBI	GATC	1 cut(s)	130
BstMWI	GCNNNNNNNGC	3 cut(s)	40, 155, 161
BstNSI	RCATGY	1 cut(s)	104
BstSFI	CTRYAG	3 cut(s)	6, 150, 159
BstSNI	TACGTA	1 cut(s)	192
BstV1I	GCAGC	3 cut(s)	142, 145, 173
BsuRI	GGCC	1 cut(s)	62
BtsI	GCAGTG	1 cut(s)	15
BtsIMutI	CAGTG	1 cut(s)	15
Cac8I	GCNNGC	1 cut(s)	32
CciI	TCATGA	1 cut(s)	166
Cfr13I	GGNCC	1 cut(s)	60
CviAII	CATG	2 cut(s)	101, 167
CviJI	RGCY	6 cut(s)	34, 43, 62, 149, 155, 164
CviKI_1	RGCY	6 cut(s)	34, 43, 62, 149, 155, 164
DpnI	GATC	1 cut(s)	132
DpnII	GATC	1 cut(s)	130
Eco105I	TACGTA	1 cut(s)	192
Eco57I	CTGAAG	2 cut(s)	65, 126
FaeI	CATG	2 cut(s)	104, 170
FaiI	YATR	3 cut(s)	22, 102, 168
FatI	CATG	2 cut(s)	100, 166
FbaI	TGATCA	1 cut(s)	130
Fnu4HI	GCNGC	3 cut(s)	156, 159, 162
Fsp4HI	GCNGC	3 cut(s)	156, 159, 162
GluI	GCNGC	3 cut(s)	156, 159, 162
GsaI	CCCAGC	1 cut(s)	38
HaeIII	GGCC	1 cut(s)	62
Hin1II	CATG	2 cut(s)	104, 170
HphI	GGTGA	4 cut(s)	37, 106, 134, 190
Hpy188III	TCNNGA	1 cut(s)	167
Hpy99I	CGWCG	1 cut(s)	88
HpyAV	CCTTC	5 cut(s)	40, 46, 85, 101, 164
HpyCH4IV	ACGT	1 cut(s)	191
HpyCH4V	TGCA	2 cut(s)	8, 161
HpyF10VI	GCNNNNNNNGC	3 cut(s)	40, 155, 161
HpySE526I	ACGT	1 cut(s)	191
Hsp92II	CATG	2 cut(s)	104, 170
Ksp22I	TGATCA	1 cut(s)	130
Kzo9I	GATC	1 cut(s)	130
LpnPI	CCDG	2 cut(s)	20, 159
Lsp1109I	GCAGC	3 cut(s)	142, 145, 173
MaeII	ACGT	1 cut(s)	191
MalI	GATC	1 cut(s)	132
MboI	GATC	1 cut(s)	130
MboII	GAAGA	1 cut(s)	100
MnlI	CCTC	4 cut(s)	10, 104, 112, 118
MslI	CAYNNNNRTG	1 cut(s)	171
MspA1I	CMGCKG	1 cut(s)	149
MwoI	GCNNNNNNNGC	3 cut(s)	40, 155, 161
NdeII	GATC	1 cut(s)	130
NlaIII	CATG	2 cut(s)	104, 170
NlaIV	GGNNCC	1 cut(s)	61
NspI	RCATGY	1 cut(s)	104
PagI	TCATGA	1 cut(s)	166
PkrI	GCNGC	3 cut(s)	157, 160, 163
Ppu21I	YACGTR	1 cut(s)	192
PspFI	CCCAGC	1 cut(s)	34
PspN4I	GGNNCC	1 cut(s)	61
PspPI	GGNCC	1 cut(s)	60
PstI	CTGCAG	2 cut(s)	10, 163
PvuII	CAGCTG	1 cut(s)	149
RseI	CAYNNNNRTG	1 cut(s)	171
SatI	GCNGC	3 cut(s)	156, 159, 162
Sau3AI	GATC	1 cut(s)	130
Sau96I	GGNCC	1 cut(s)	60
SfcI	CTRYAG	3 cut(s)	6, 150, 159
SgeI	CNNG	6 cut(s)	43, 47, 76, 113, 158, 179
SmiMI	CAYNNNNRTG	1 cut(s)	171
SnaBI	TACGTA	1 cut(s)	192
SsiI	CCGC	2 cut(s)	70, 176
TaiI	ACGT	1 cut(s)	194
TaqI	TCGA	1 cut(s)	86
TscAI	CASTG	1 cut(s)	15
TseI	GCWGC	3 cut(s)	155, 158, 161
TspDTI	ATGAA	1 cut(s)	183
TspRI	CASTG	1 cut(s)	15
XceI	RCATGY	1 cut(s)	104

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.