Rroxscaffold_7G00207410

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
57288486 .. 57288749
264 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00207410.1

Sequence Viewer

Length: 264 bp
ATGTCTGCAGTGGTGGAGGTATGGGTGAGCGAGCTGGGGAAGCTGAAGGAGAAGGTTGGGGCCAAGAAGCGGTTTCTGTGGTCGTCGAAGAAGGTGAAACATGCTGAAGGAGGAGATGAGGGTAAGGTTGATCAGCAACAACAACCAGCTGTAGCTCATGAAGGTGCGGAGATGGAGACTACGGTTAGAAAAGAGAGGAGGAACTCTTCTACGCTTTCTGAGGCCACTGTTTGTATGCTCATGGACCGTTTTGTTCCTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.8

Weight (kDa)

8.82

Isoelectric Point (pI)

41.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 70, 167
AcuI CTGAAG 2 cut(s) 65, 126
AfiI CCNNNNNNNGG 1 cut(s) 69
AluBI AGCT 4 cut(s) 34, 43, 149, 155
AluI AGCT 4 cut(s) 34, 43, 149, 155
Alw26I GTCTC 1 cut(s) 170
AoxI GGCC 2 cut(s) 60, 222
AspS9I GGNCC 2 cut(s) 60, 244
AsuHPI GGTGA 2 cut(s) 37, 106
AvaII GGWCC 1 cut(s) 244
BccI CCATC 1 cut(s) 166
BclI TGATCA 1 cut(s) 130
BcoDI GTCTC 1 cut(s) 170
BfmI CTRYAG 2 cut(s) 6, 150
Bme18I GGWCC 1 cut(s) 244
BmgT120I GGNCC 2 cut(s) 60, 244
BmiI GGNNCC 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 257
Bsc4I CCNNNNNNNGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 257
BseLI CCNNNNNNNGG 1 cut(s) 69
BseMII CTCAG 1 cut(s) 210
BseRI GAGGAG 2 cut(s) 126, 211
BseYI CCCAGC 1 cut(s) 34
BshFI GGCC 2 cut(s) 62, 224
BslI CCNNNNNNNGG 1 cut(s) 69
BsmAI GTCTC 1 cut(s) 170
BsnI GGCC 2 cut(s) 62, 224
Bsp143I GATC 1 cut(s) 130
BspACI CCGC 2 cut(s) 70, 167
BspANI GGCC 2 cut(s) 62, 224
BspCNI CTCAG 1 cut(s) 211
BspHI TCATGA 1 cut(s) 157
BspLI GGNNCC 1 cut(s) 61
BspMAI CTGCAG 1 cut(s) 10
BssECI CCNNGG 1 cut(s) 257
BssMI GATC 1 cut(s) 130
BssT1I CCWWGG 1 cut(s) 257
Bst4CI ACNGT 3 cut(s) 184, 229, 248
Bst6I CTCTTC 1 cut(s) 211
BstC8I GCNNGC 1 cut(s) 32
BstDEI CTNAG 1 cut(s) 219
BstKTI GATC 1 cut(s) 133
BstMAI GTCTC 1 cut(s) 170
BstMBI GATC 1 cut(s) 130
BstMWI GCNNNNNNNGC 1 cut(s) 40
BstNSI RCATGY 1 cut(s) 104
BstSFI CTRYAG 2 cut(s) 6, 150
BsuRI GGCC 2 cut(s) 62, 224
BtsI GCAGTG 1 cut(s) 15
BtsIMutI CAGTG 2 cut(s) 15, 225
Cac8I GCNNGC 1 cut(s) 32
CciI TCATGA 1 cut(s) 157
Cfr13I GGNCC 2 cut(s) 60, 244
CviAII CATG 3 cut(s) 101, 158, 241
CviJI RGCY 6 cut(s) 34, 43, 62, 149, 155, 224
CviKI_1 RGCY 6 cut(s) 34, 43, 62, 149, 155, 224
DdeI CTNAG 1 cut(s) 219
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
Eam1104I CTCTTC 1 cut(s) 211
EarI CTCTTC 1 cut(s) 211
Eco130I CCWWGG 1 cut(s) 257
Eco47I GGWCC 1 cut(s) 244
Eco57I CTGAAG 2 cut(s) 65, 126
EcoT14I CCWWGG 1 cut(s) 257
ErhI CCWWGG 1 cut(s) 257
FaeI CATG 3 cut(s) 104, 161, 244
FaiI YATR 5 cut(s) 22, 102, 159, 236, 242
FatI CATG 3 cut(s) 100, 157, 240
FbaI TGATCA 1 cut(s) 130
GsaI CCCAGC 1 cut(s) 38
HaeIII GGCC 2 cut(s) 62, 224
Hin1II CATG 3 cut(s) 104, 161, 244
HphI GGTGA 2 cut(s) 37, 106
Hpy188I TCNGA 1 cut(s) 220
Hpy188III TCNNGA 1 cut(s) 158
Hpy99I CGWCG 1 cut(s) 88
HpyAV CCTTC 5 cut(s) 40, 46, 85, 101, 155
HpyCH4III ACNGT 3 cut(s) 184, 229, 248
HpyCH4V TGCA 1 cut(s) 8
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
HpyF3I CTNAG 1 cut(s) 219
Hsp92II CATG 3 cut(s) 104, 161, 244
Ksp22I TGATCA 1 cut(s) 130
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 2 cut(s) 20, 159
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 2 cut(s) 100, 198
MnlI CCTC 6 cut(s) 10, 104, 112, 189, 192, 214
MslI CAYNNNNRTG 1 cut(s) 162
MspA1I CMGCKG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 40
NdeII GATC 1 cut(s) 130
NlaIII CATG 3 cut(s) 104, 161, 244
NlaIV GGNNCC 1 cut(s) 61
NspI RCATGY 1 cut(s) 104
PagI TCATGA 1 cut(s) 157
PspFI CCCAGC 1 cut(s) 34
PspN4I GGNNCC 1 cut(s) 61
PspPI GGNCC 2 cut(s) 60, 244
PstI CTGCAG 1 cut(s) 10
PvuII CAGCTG 1 cut(s) 149
RseI CAYNNNNRTG 1 cut(s) 162
Sau3AI GATC 1 cut(s) 130
Sau96I GGNCC 2 cut(s) 60, 244
SetI ASST 9 cut(s) 21, 36, 45, 57, 96, 129, 151, 157, 166
SfcI CTRYAG 2 cut(s) 6, 150
SgeI CNNG 7 cut(s) 43, 47, 76, 113, 158, 170, 253
SinI GGWCC 1 cut(s) 244
SmiMI CAYNNNNRTG 1 cut(s) 162
SsiI CCGC 2 cut(s) 70, 167
StyI CCWWGG 1 cut(s) 257
TaaI ACNGT 3 cut(s) 184, 229, 248
TaqI TCGA 1 cut(s) 86
TscAI CASTG 2 cut(s) 15, 232
TspDTI ATGAA 1 cut(s) 174
TspRI CASTG 2 cut(s) 15, 232
VpaK11BI GGWCC 1 cut(s) 244
XceI RCATGY 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.