Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp08

Orthogroup ID

OG0006473

Physical Location & Seq

Genomic Coordinates Reverse (-)

22362626 .. 22363309

Gene Structure 684 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.8G268200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

GGTGGCATAGGTCCTGCTGGGCATTCTACAGACGATCTCTATGTGCTTGATTTAACCAACGATAAGTTTAAATGGCACAGAGTGGTTGTACATGGACAAGGACCTGGGCCTCGGTATGGCCATGTAATGGACTTAGTTGCTCAAAGATATCTTGTTACTGTCAGTGGAAACGATGGAAAAAGAGTTCTTTCTGATGCATGGGCTCTGGATACTGCCCAGAAACCTTATGCATGGGCAAGGCTGAACCCAGAAGGTGACAGGCCTTCTGCTAGAATGTATGCAACAGCCAGTGCCCGCTCAGATGGCATGTTTTTGCTGTTAAACGTAATACATTTGTATAAGTTGTTAAAATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kelch_3 Kelch_4 Metallophos STPPase_N

Protein Analysis

118

Amino Acids

12.95

Weight (kDa)

9.3

Isoelectric Point (pI)

16.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006473)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G03080
fragaria_vesca	FvH4_2g24460 FvH4_2g24460 FvH4_2g24460 FvH4_2g24460
malus_domestica	MD03G1274100.v1.1 MD11G1296400.v1.1
prunus_persica	Prupe.8G250300_v2.0.a1 Prupe.8G268100_v2.0.a1 Prupe.8G268200_v2.0.a1
pyrus_communis	pycom03g21840 pycom03g21850 pycom11g26080
rosa_chinensis	RchiOBHm_Chr6g0292301
rosa_laevigata	RLG00000012044
rosa_multiflora	Rmu_co8058994.1_g000001 Rmu_co8428867.1_g000001 Rmu_sc0002993.1_g000020 Rmu_sc0011960.1_g000001
rosa_roxburghii	Rroxscaffold_7G00175230
rosa_rugosa	Rorug06G0225300
rosa_samantha	Rh6AG338700 Rh6BG345800 Rh6CG352900 Rh6DG338700
rosa_wichuraiana	Rw6G029480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	127
AccBSI	CCGCTC	1 cut(s)	297
AciI	CCGC	1 cut(s)	295
AcoI	YGGCCR	1 cut(s)	118
AdeI	CACNNNGTG	1 cut(s)	82
AfaI	GTAC	1 cut(s)	90
AfiI	CCNNNNNNNGG	2 cut(s)	116, 127
AjnI	CCWGG	1 cut(s)	103
AloI	GAACNNNNNNTCC	2 cut(s)	168, 200
AoxI	GGCC	3 cut(s)	107, 118, 260
AspS9I	GGNCC	3 cut(s)	11, 101, 107
AsuHPI	GGTGA	1 cut(s)	266
AvaII	GGWCC	2 cut(s)	11, 101
BaeGI	GKGCMC	1 cut(s)	295
BalI	TGGCCA	1 cut(s)	120
BanII	GRGCYC	1 cut(s)	205
BccI	CCATC	2 cut(s)	167, 296
BciT130I	CCWGG	1 cut(s)	105
BciVI	GTATCC	1 cut(s)	202
BfaI	CTAG	1 cut(s)	270
BfmI	CTRYAG	1 cut(s)	27
BfuI	GTATCC	1 cut(s)	202
Bme1390I	CCNGG	1 cut(s)	105
Bme18I	GGWCC	2 cut(s)	11, 101
BmgT120I	GGNCC	3 cut(s)	11, 101, 107
BmrFI	CCNGG	1 cut(s)	105
BmsI	GCATC	1 cut(s)	184
BsaJI	CCNNGG	2 cut(s)	104, 110
Bsc4I	CCNNNNNNNGG	2 cut(s)	116, 127
Bse1I	ACTGG	1 cut(s)	288
BseBI	CCWGG	1 cut(s)	105
BseDI	CCNNGG	2 cut(s)	104, 110
BseLI	CCNNNNNNNGG	2 cut(s)	116, 127
BseMII	CTCAG	1 cut(s)	312
BseNI	ACTGG	1 cut(s)	288
BseSI	GKGCMC	1 cut(s)	295
BseYI	CCCAGC	1 cut(s)	17
BshFI	GGCC	3 cut(s)	109, 120, 262
BslI	CCNNNNNNNGG	2 cut(s)	116, 127
BsmI	GAATGC	1 cut(s)	22
BsnI	GGCC	3 cut(s)	109, 120, 262
Bsp1286I	GDGCHC	2 cut(s)	205, 295
Bsp1407I	TGTACA	1 cut(s)	88
Bsp143I	GATC	1 cut(s)	34
BspACI	CCGC	1 cut(s)	295
BspANI	GGCC	3 cut(s)	109, 120, 262
BspCNI	CTCAG	1 cut(s)	311
BsrBI	CCGCTC	1 cut(s)	297
BsrGI	TGTACA	1 cut(s)	88
BsrI	ACTGG	1 cut(s)	288
BssECI	CCNNGG	2 cut(s)	104, 110
BssMI	GATC	1 cut(s)	34
Bst2UI	CCWGG	1 cut(s)	105
Bst4CI	ACNGT	1 cut(s)	160
BstAUI	TGTACA	1 cut(s)	88
BstC8I	GCNNGC	1 cut(s)	295
BstDEI	CTNAG	2 cut(s)	133, 298
BstKTI	GATC	1 cut(s)	37
BstMBI	GATC	1 cut(s)	34
BstMWI	GCNNNNNNNGC	1 cut(s)	303
BstNI	CCWGG	1 cut(s)	105
BstNSI	RCATGY	1 cut(s)	310
BstSCI	CCNGG	1 cut(s)	103
BstSFI	CTRYAG	1 cut(s)	27
BstSLI	GKGCMC	1 cut(s)	295
BsuI	GTATCC	1 cut(s)	202
BsuRI	GGCC	3 cut(s)	109, 120, 262
BtsIMutI	CAGTG	2 cut(s)	169, 295
Cac8I	GCNNGC	1 cut(s)	295
Cfr13I	GGNCC	3 cut(s)	11, 101, 107
Csp6I	GTAC	1 cut(s)	89
CviAII	CATG	5 cut(s)	92, 122, 198, 231, 307
CviJI	RGCY	6 cut(s)	109, 120, 203, 241, 262, 287
CviKI_1	RGCY	6 cut(s)	109, 120, 203, 241, 262, 287
CviQI	GTAC	1 cut(s)	89
DdeI	CTNAG	2 cut(s)	133, 298
DpnI	GATC	1 cut(s)	36
DpnII	GATC	1 cut(s)	34
DraI	TTTAAA	1 cut(s)	70
DraIII	CACNNNGTG	1 cut(s)	82
EaeI	YGGCCR	1 cut(s)	118
Eco147I	AGGCCT	1 cut(s)	262
Eco24I	GRGCYC	1 cut(s)	205
Eco32I	GATATC	1 cut(s)	149
Eco47I	GGWCC	2 cut(s)	11, 101
EcoO109I	RGGNCCY	2 cut(s)	11, 101
EcoRII	CCWGG	1 cut(s)	103
EcoRV	GATATC	1 cut(s)	149
EcoT22I	ATGCAT	2 cut(s)	199, 232
EcoT38I	GRGCYC	1 cut(s)	205
FaeI	CATG	5 cut(s)	95, 125, 201, 234, 310
FatI	CATG	5 cut(s)	91, 121, 197, 230, 306
FauI	CCCGC	1 cut(s)	302
FriOI	GRGCYC	1 cut(s)	205
FspBI	CTAG	1 cut(s)	270
GsaI	CCCAGC	1 cut(s)	21
HaeIII	GGCC	3 cut(s)	109, 120, 262
Hin1II	CATG	5 cut(s)	95, 125, 201, 234, 310
HphI	GGTGA	1 cut(s)	266
Hpy188I	TCNGA	2 cut(s)	193, 301
Hpy188III	TCNNGA	1 cut(s)	206
HpyAV	CCTTC	2 cut(s)	245, 273
HpyCH4III	ACNGT	1 cut(s)	160
HpyCH4IV	ACGT	1 cut(s)	324
HpyCH4V	TGCA	3 cut(s)	197, 230, 281
HpyF10VI	GCNNNNNNNGC	1 cut(s)	303
HpyF3I	CTNAG	2 cut(s)	133, 298
HpySE526I	ACGT	1 cut(s)	324
Hsp92II	CATG	5 cut(s)	95, 125, 201, 234, 310
Kzo9I	GATC	1 cut(s)	34
LpnPI	CCDG	9 cut(s)	3, 27, 90, 117, 191, 230, 244, 261, 301
LweI	GCATC	1 cut(s)	184
MaeI	CTAG	1 cut(s)	270
MaeII	ACGT	1 cut(s)	324
MaeIII	GTNAC	2 cut(s)	154, 254
MalI	GATC	1 cut(s)	36
MbiI	CCGCTC	1 cut(s)	297
MboI	GATC	1 cut(s)	34
MhlI	GDGCHC	2 cut(s)	205, 295
MlsI	TGGCCA	1 cut(s)	120
MluNI	TGGCCA	1 cut(s)	120
MnlI	CCTC	1 cut(s)	120
Mox20I	TGGCCA	1 cut(s)	120
Mph1103I	ATGCAT	2 cut(s)	199, 232
MscI	TGGCCA	1 cut(s)	120
MseI	TTAA	4 cut(s)	53, 69, 320, 347
Msp20I	TGGCCA	1 cut(s)	120
MspR9I	CCNGG	1 cut(s)	105
Mva1269I	GAATGC	1 cut(s)	22
MvaI	CCWGG	1 cut(s)	105
MwoI	GCNNNNNNNGC	1 cut(s)	303
NdeII	GATC	1 cut(s)	34
NlaIII	CATG	5 cut(s)	95, 125, 201, 234, 310
NmuCI	GTSAC	1 cut(s)	254
NsiI	ATGCAT	2 cut(s)	199, 232
NspI	RCATGY	1 cut(s)	310
PceI	AGGCCT	1 cut(s)	262
PctI	GAATGC	1 cut(s)	22
PflMI	CCANNNNNTGG	1 cut(s)	127
PpuMI	RGGWCCY	2 cut(s)	11, 101
Psp5II	RGGWCCY	2 cut(s)	11, 101
Psp6I	CCWGG	1 cut(s)	103
PspFI	CCCAGC	1 cut(s)	17
PspGI	CCWGG	1 cut(s)	103
PspPI	GGNCC	3 cut(s)	11, 101, 107
PspPPI	RGGWCCY	2 cut(s)	11, 101
RsaI	GTAC	1 cut(s)	90
RsaNI	GTAC	1 cut(s)	89
SaqAI	TTAA	4 cut(s)	53, 69, 320, 347
Sau3AI	GATC	1 cut(s)	34
Sau96I	GGNCC	3 cut(s)	11, 101, 107
ScrFI	CCNGG	1 cut(s)	105
SduI	GDGCHC	2 cut(s)	205, 295
SetI	ASST	5 cut(s)	13, 106, 226, 256, 327
SfaNI	GCATC	1 cut(s)	184
SfcI	CTRYAG	1 cut(s)	27
SinI	GGWCC	2 cut(s)	11, 101
SseBI	AGGCCT	1 cut(s)	262
SsiI	CCGC	1 cut(s)	295
SspMI	CTAG	1 cut(s)	270
StuI	AGGCCT	1 cut(s)	262
StyD4I	CCNGG	1 cut(s)	103
TaaI	ACNGT	1 cut(s)	160
TaiI	ACGT	1 cut(s)	327
TatI	WGTACW	1 cut(s)	88
Tru1I	TTAA	4 cut(s)	53, 69, 320, 347
Tru9I	TTAA	4 cut(s)	53, 69, 320, 347
TscAI	CASTG	2 cut(s)	169, 295
TseFI	GTSAC	1 cut(s)	254
Tsp45I	GTSAC	1 cut(s)	254
TspRI	CASTG	2 cut(s)	169, 295
Van91I	CCANNNNNTGG	1 cut(s)	127
VpaK11BI	GGWCC	2 cut(s)	11, 101
XceI	RCATGY	1 cut(s)	310
XspI	CTAG	1 cut(s)	270
Zsp2I	ATGCAT	2 cut(s)	199, 232

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.