Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011960.1

Orthogroup ID

OG0006473

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1868

Gene Structure 1868 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011960.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1053 bp

atggagaaactacggcaggcttctgctgccgaagctgaggcagctagtgctgtttggcaagctgtgcagtcccaatcttcccctcctcctgaagaaacttctgtttcagatgacaactcacaaattgcagaaacactttcggatggtagtgacactgaggcagatgttcgccttcatcccagagctgttgttgttgccaaagaggctgtaggcaatttgggtggcatggtaagacagttgtctttggatcaattcgaaaatgagagcagacgaatgattccaatgaataacgacttatcatatcctaacaaaaagtttaccaggcagaagtccccacagggcttacataagaagataatatctacattgctgaggccaaggaactggaaacctccggttaataggaagtttttcctcgattcttacgaagtgggagaactttgttatgctgctgaacagatctttatgcaggagcaaacagttcttcagctgaaagctcctgttaaagtatttggcgatcttcatggacagtttggtgatttaatgcgcttgtttgatgaatatggatttccatctgctgcaggagacataacgtacattgactacttgtttttgggggattatgttgatcgaggacagcacagcttggagacaataactctactccttgcactcaagatcgagtatcctgataatgttcacttaatacgtggaaaccatgaggctgctgatatcaacgcactctttggttttcgtattgaatgcattgagagaatgggagagagtgatggaatatgggcatggacaaggttcaatcaacttttcaactacctcccactggctgcactaattgaaaagaaaatcatctgtatgcatggtggcatcggaagatctataaattctgtagaacaaatagagaagcttgaaagacccattacaatggatgctgggtctataattttgatggatcttctatggtctgatccgacagaaaacgatggtgtagagggtctcagaccaaatgcaagagggcctggtcttgtcacttttggg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kelch_3 Kelch_4 Metallophos STPPase_N

Protein Analysis

351

Amino Acids

39.3

Weight (kDa)

5.03

Isoelectric Point (pI)

42.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006473)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G03080
fragaria_vesca	FvH4_2g24460 FvH4_2g24460 FvH4_2g24460 FvH4_2g24460
malus_domestica	MD03G1274100.v1.1 MD11G1296400.v1.1
prunus_persica	Prupe.8G250300_v2.0.a1 Prupe.8G268100_v2.0.a1 Prupe.8G268200_v2.0.a1
pyrus_communis	pycom03g21840 pycom03g21850 pycom11g26080
rosa_chinensis	RchiOBHm_Chr6g0292301
rosa_laevigata	RLG00000012044
rosa_multiflora	Rmu_co8058994.1_g000001 Rmu_co8428867.1_g000001 Rmu_sc0002993.1_g000020 Rmu_sc0011960.1_g000001
rosa_roxburghii	Rroxscaffold_7G00175230
rosa_rugosa	Rorug06G0225300
rosa_samantha	Rh6AG338700 Rh6BG345800 Rh6CG352900 Rh6DG338700
rosa_wichuraiana	Rw6G029480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	255, 975, 977
AcsI	RAATTY	1 cut(s)	898
AcuI	CTGAAG	2 cut(s)	111, 470
AfaI	GTAC	1 cut(s)	596
AfiI	CCNNNNNNNGG	1 cut(s)	838
AgsI	TTSAA	5 cut(s)	761, 814, 826, 854, 926
AjnI	CCWGG	2 cut(s)	320, 1033
AluBI	AGCT	8 cut(s)	35, 44, 62, 185, 490, 497, 645, 922
AluI	AGCT	8 cut(s)	35, 44, 62, 185, 490, 497, 645, 922
Alw26I	GTCTC	3 cut(s)	579, 644, 1016
AlwI	GGATC	3 cut(s)	255, 975, 977
AoxI	GGCC	2 cut(s)	374, 1031
ApeKI	GCWGC	6 cut(s)	26, 41, 449, 578, 725, 842
ApoI	RAATTY	1 cut(s)	898
Asp700I	GAANNNNTTC	1 cut(s)	410
AspLEI	GCGC	1 cut(s)	549
AspS9I	GGNCC	1 cut(s)	1031
AsuHPI	GGTGA	1 cut(s)	548
AsuII	TTCGAA	1 cut(s)	255
BbvCI	CCTCAGC	2 cut(s)	36, 371
BbvI	GCAGC	6 cut(s)	13, 53, 436, 565, 712, 829
BccI	CCATC	5 cut(s)	137, 580, 782, 958, 992
BceAI	ACGGC	1 cut(s)	29
BciT130I	CCWGG	2 cut(s)	322, 1035
BciVI	GTATCC	1 cut(s)	696
BcoDI	GTCTC	3 cut(s)	579, 644, 1016
BfaI	CTAG	1 cut(s)	45
BfmI	CTRYAG	3 cut(s)	207, 579, 903
BfuI	GTATCC	1 cut(s)	696
BglI	GCCNNNNNGGC	1 cut(s)	203
BglII	AGATCT	2 cut(s)	459, 890
BisI	GCNGC	6 cut(s)	27, 42, 450, 579, 726, 843
BlsI	GCNGC	6 cut(s)	28, 43, 451, 580, 727, 844
Bme1390I	CCNGG	2 cut(s)	322, 1035
BmgT120I	GGNCC	1 cut(s)	1031
BmrFI	CCNGG	2 cut(s)	322, 1035
BmsI	GCATC	2 cut(s)	891, 934
BoxI	GACNNNNGTC	1 cut(s)	238
Bpu10I	CCTNAGC	2 cut(s)	36, 371
Bpu14I	TTCGAA	1 cut(s)	255
BpuEI	CTTGAG	1 cut(s)	659
BsaAI	YACGTR	1 cut(s)	710
BsaBI	GATNNNNATC	1 cut(s)	571
BsaI	GGTCTC	1 cut(s)	1016
BsaJI	CCNNGG	1 cut(s)	377
BsaWI	WCCGGW	1 cut(s)	394
Bsc4I	CCNNNNNNNGG	1 cut(s)	838
Bse1I	ACTGG	2 cut(s)	389, 843
Bse3DI	GCAATG	1 cut(s)	365
Bse8I	GATNNNNATC	1 cut(s)	571
BseBI	CCWGG	2 cut(s)	322, 1035
BseDI	CCNNGG	1 cut(s)	377
BseGI	GGATG	3 cut(s)	148, 175, 949
BseJI	GATNNNNATC	1 cut(s)	571
BseLI	CCNNNNNNNGG	1 cut(s)	838
BseMI	GCAATG	1 cut(s)	365
BseMII	CTCAG	4 cut(s)	27, 147, 362, 1027
BseNI	ACTGG	2 cut(s)	389, 843
BseRI	GAGGAG	1 cut(s)	75
BseXI	GCAGC	6 cut(s)	13, 53, 436, 565, 712, 829
BseYI	CCCAGC	1 cut(s)	947
BsgI	GTGCAG	2 cut(s)	86, 828
BshFI	GGCC	2 cut(s)	376, 1033
BsiSI	CCGG	1 cut(s)	395
BslFI	GGGAC	2 cut(s)	55, 316
BslI	CCNNNNNNNGG	1 cut(s)	838
BsmAI	GTCTC	3 cut(s)	579, 644, 1016
BsmFI	GGGAC	2 cut(s)	55, 316
BsmI	GAATGC	1 cut(s)	767
BsnI	GGCC	2 cut(s)	376, 1033
Bso31I	GGTCTC	1 cut(s)	1016
Bsp119I	TTCGAA	1 cut(s)	255
Bsp143I	GATC	8 cut(s)	247, 459, 517, 628, 678, 890, 967, 982
BspANI	GGCC	2 cut(s)	376, 1033
BspCNI	CTCAG	4 cut(s)	28, 148, 363, 1026
BspMAI	CTGCAG	1 cut(s)	583
BspPI	GGATC	3 cut(s)	255, 975, 977
BspT104I	TTCGAA	1 cut(s)	255
BspTNI	GGTCTC	1 cut(s)	1016
BsrDI	GCAATG	1 cut(s)	365
BsrI	ACTGG	2 cut(s)	389, 843
BssECI	CCNNGG	1 cut(s)	377
BssMI	GATC	8 cut(s)	247, 459, 517, 628, 678, 890, 967, 982
BssT1I	CCWWGG	1 cut(s)	377
Bst2UI	CCWGG	2 cut(s)	322, 1035
Bst4CI	ACNGT	3 cut(s)	237, 481, 531
BstAPI	GCANNNNNTGC	2 cut(s)	47, 64
BstBAI	YACGTR	1 cut(s)	710
BstBI	TTCGAA	1 cut(s)	255
BstC8I	GCNNGC	2 cut(s)	18, 60
BstDEI	CTNAG	4 cut(s)	36, 156, 371, 1013
BstF5I	GGATG	3 cut(s)	148, 175, 949
BstHHI	GCGC	1 cut(s)	549
BstKTI	GATC	8 cut(s)	250, 462, 520, 631, 681, 893, 970, 985
BstMAI	GTCTC	3 cut(s)	579, 644, 1016
BstMBI	GATC	8 cut(s)	247, 459, 517, 628, 678, 890, 967, 982
BstMWI	GCNNNNNNNGC	6 cut(s)	26, 32, 41, 47, 64, 203
BstNI	CCWGG	2 cut(s)	322, 1035
BstPAI	GACNNNNGTC	1 cut(s)	238
BstSCI	CCNGG	2 cut(s)	320, 1033
BstSFI	CTRYAG	3 cut(s)	207, 579, 903
BstV1I	GCAGC	6 cut(s)	13, 53, 436, 565, 712, 829
BstX2I	RGATCY	3 cut(s)	459, 890, 967
BstXI	CCANNNNNNTGG	2 cut(s)	384, 940
BstYI	RGATCY	3 cut(s)	459, 890, 967
BsuI	GTATCC	1 cut(s)	696
BsuRI	GGCC	2 cut(s)	376, 1033
BtsCI	GGATG	3 cut(s)	148, 175, 949
BtsIMutI	CAGTG	2 cut(s)	153, 836
Cac8I	GCNNGC	2 cut(s)	18, 60
CfoI	GCGC	1 cut(s)	549
Cfr13I	GGNCC	1 cut(s)	1031
Csp6I	GTAC	1 cut(s)	595
CspCI	CAANNNNNGTGG	2 cut(s)	202, 237
CviAII	CATG	5 cut(s)	226, 524, 719, 801, 875
CviQI	GTAC	1 cut(s)	595
DdeI	CTNAG	4 cut(s)	36, 156, 371, 1013
DpnI	GATC	8 cut(s)	249, 461, 519, 630, 680, 892, 969, 984
DpnII	GATC	8 cut(s)	247, 459, 517, 628, 678, 890, 967, 982
Eco130I	CCWWGG	1 cut(s)	377
Eco31I	GGTCTC	1 cut(s)	1016
Eco32I	GATATC	1 cut(s)	733
Eco57I	CTGAAG	2 cut(s)	111, 470
EcoO109I	RGGNCCY	1 cut(s)	1031
EcoRII	CCWGG	2 cut(s)	320, 1033
EcoRV	GATATC	1 cut(s)	733
EcoT14I	CCWWGG	1 cut(s)	377
EcoT22I	ATGCAT	2 cut(s)	767, 876
ErhI	CCWWGG	1 cut(s)	377
FaeI	CATG	5 cut(s)	229, 527, 722, 804, 878
FaqI	GGGAC	2 cut(s)	55, 316
FatI	CATG	5 cut(s)	225, 523, 718, 800, 874
Fnu4HI	GCNGC	6 cut(s)	27, 42, 450, 579, 726, 843
FokI	GGATG	3 cut(s)	155, 162, 956
Fsp4HI	GCNGC	6 cut(s)	27, 42, 450, 579, 726, 843
FspBI	CTAG	1 cut(s)	45
GlaI	GCGC	1 cut(s)	548
GluI	GCNGC	6 cut(s)	27, 42, 450, 579, 726, 843
GsaI	CCCAGC	1 cut(s)	951
HaeIII	GGCC	2 cut(s)	376, 1033
HapII	CCGG	1 cut(s)	395
HhaI	GCGC	1 cut(s)	549
Hin1II	CATG	5 cut(s)	229, 527, 722, 804, 878
Hin6I	GCGC	1 cut(s)	547
HinP1I	GCGC	1 cut(s)	547
HindIII	AAGCTT	1 cut(s)	920
HinfI	GANTC	2 cut(s)	277, 419
HpaII	CCGG	1 cut(s)	395
HphI	GGTGA	1 cut(s)	548
Hpy166II	GTNNAC	2 cut(s)	318, 700
Hpy188I	TCNGA	6 cut(s)	109, 142, 887, 982, 987, 1016
Hpy188III	TCNNGA	3 cut(s)	89, 676, 689
Hpy8I	GTNNAC	2 cut(s)	318, 700
HpyAV	CCTTC	1 cut(s)	182
HpyCH4III	ACNGT	3 cut(s)	237, 481, 531
HpyCH4IV	ACGT	2 cut(s)	593, 709
HpyCH4V	TGCA	9 cut(s)	67, 128, 469, 581, 671, 765, 845, 874, 1025
HpyF10VI	GCNNNNNNNGC	6 cut(s)	26, 32, 41, 47, 64, 203
HpyF3I	CTNAG	4 cut(s)	36, 156, 371, 1013
HpySE526I	ACGT	2 cut(s)	593, 709
Hsp92II	CATG	5 cut(s)	229, 527, 722, 804, 878
HspAI	GCGC	1 cut(s)	547
Kzo9I	GATC	8 cut(s)	247, 459, 517, 628, 678, 890, 967, 982
LmnI	GCTCC	2 cut(s)	472, 502
Lsp1109I	GCAGC	6 cut(s)	13, 53, 436, 565, 712, 829
LweI	GCATC	2 cut(s)	891, 934
MaeI	CTAG	1 cut(s)	45
MaeII	ACGT	2 cut(s)	593, 709
MaeIII	GTNAC	2 cut(s)	149, 1042
MalI	GATC	8 cut(s)	249, 461, 519, 630, 680, 892, 969, 984
MboI	GATC	8 cut(s)	247, 459, 517, 628, 678, 890, 967, 982
MboII	GAAGA	7 cut(s)	69, 104, 364, 476, 512, 900, 962
MflI	RGATCY	3 cut(s)	459, 890, 967
MluCI	AATT	6 cut(s)	123, 214, 251, 849, 898, 957
MmeI	TCCRAC	1 cut(s)	1010
Mph1103I	ATGCAT	2 cut(s)	767, 876
MroXI	GAANNNNTTC	1 cut(s)	410
MseI	TTAA	4 cut(s)	399, 504, 542, 704
MslI	CAYNNNNRTG	2 cut(s)	869, 938
MspA1I	CMGCKG	1 cut(s)	490
MspI	CCGG	1 cut(s)	395
MspR9I	CCNGG	2 cut(s)	322, 1035
Mva1269I	GAATGC	1 cut(s)	767
MvaI	CCWGG	2 cut(s)	322, 1035
MwoI	GCNNNNNNNGC	6 cut(s)	26, 32, 41, 47, 64, 203
NdeII	GATC	8 cut(s)	247, 459, 517, 628, 678, 890, 967, 982
NlaIII	CATG	5 cut(s)	229, 527, 722, 804, 878
NmuCI	GTSAC	2 cut(s)	149, 1042
NsiI	ATGCAT	2 cut(s)	767, 876
NspV	TTCGAA	1 cut(s)	255
PcsI	WCGNNNNNNNCGW	1 cut(s)	423
PctI	GAATGC	1 cut(s)	767
PdmI	GAANNNNTTC	1 cut(s)	410
PfeI	GAWTC	2 cut(s)	277, 419
PkrI	GCNGC	6 cut(s)	28, 43, 451, 580, 727, 844
Ppu21I	YACGTR	1 cut(s)	710
PshAI	GACNNNNGTC	1 cut(s)	238
Psp6I	CCWGG	2 cut(s)	320, 1033
PspFI	CCCAGC	1 cut(s)	947
PspGI	CCWGG	2 cut(s)	320, 1033
PspPI	GGNCC	1 cut(s)	1031
PstI	CTGCAG	1 cut(s)	583
PsuI	RGATCY	3 cut(s)	459, 890, 967
PvuII	CAGCTG	1 cut(s)	490
RsaI	GTAC	1 cut(s)	596
RsaNI	GTAC	1 cut(s)	595
RseI	CAYNNNNRTG	2 cut(s)	869, 938
SaqAI	TTAA	4 cut(s)	399, 504, 542, 704
SatI	GCNGC	6 cut(s)	27, 42, 450, 579, 726, 843
Sau3AI	GATC	8 cut(s)	247, 459, 517, 628, 678, 890, 967, 982
Sau96I	GGNCC	1 cut(s)	1031
ScrFI	CCNGG	2 cut(s)	322, 1035
SfaNI	GCATC	2 cut(s)	891, 934
SfcI	CTRYAG	3 cut(s)	207, 579, 903
SfuI	TTCGAA	1 cut(s)	255
SmiMI	CAYNNNNRTG	2 cut(s)	869, 938
SmlI	CTYRAG	1 cut(s)	674
SmoI	CTYRAG	1 cut(s)	674
Sse9I	AATT	6 cut(s)	123, 214, 251, 849, 898, 957
SspMI	CTAG	1 cut(s)	45
StyD4I	CCNGG	2 cut(s)	320, 1033
StyI	CCWWGG	1 cut(s)	377
TaaI	ACNGT	3 cut(s)	237, 481, 531
TaiI	ACGT	2 cut(s)	596, 712
TaqI	TCGA	4 cut(s)	255, 417, 631, 681
TasI	AATT	6 cut(s)	123, 214, 251, 849, 898, 957
TfiI	GAWTC	2 cut(s)	277, 419
Tru1I	TTAA	4 cut(s)	399, 504, 542, 704
Tru9I	TTAA	4 cut(s)	399, 504, 542, 704
TscAI	CASTG	2 cut(s)	160, 843
TseFI	GTSAC	2 cut(s)	149, 1042
TseI	GCWGC	6 cut(s)	26, 41, 449, 578, 725, 842
Tsp45I	GTSAC	2 cut(s)	149, 1042
TspDTI	ATGAA	4 cut(s)	164, 299, 512, 573
TspRI	CASTG	2 cut(s)	160, 843
XapI	RAATTY	1 cut(s)	898
XmnI	GAANNNNTTC	1 cut(s)	410
XspI	CTAG	1 cut(s)	45
Zsp2I	ATGCAT	2 cut(s)	767, 876

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.