pycom03g09440

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0004781
Physical Location & Seq
Reverse (-)
7996779 .. 7999504
2726 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g09440.1

Sequence Viewer

Length: 486 bp
ATGGATGTTGATTCACAGCCAAGTATGGAGGAAACTATTTTGGTCGGCGATGACCTGATGACAGGCCCACCATCACCAATTATTCCACCAGAAATTGCTTCTCATGTGCTGGAAGGTGTTGACTTGTGTGATGGGGTTTTGAGGAATCTATTTTTGTGTCTGCAAATCAATGATATTGAGCCTTTCTGTCAAGATGAGCTTGTTATGTATAAACAGTGCGCTGAAAAAAGGGATAAAGAACTACGAAGACGACTTCAGGACAGTGAGTGCAAATTAGGGTTATCAATGCCTTTAAATGAAGCAAAGGAAAGAGCTTCTCAGCTCGAAAAAGGCGTCACATCATTAGATAGGCGCTTGATTCTTGCTAGTGGACTCGAAGGCATAGACGGATTTCGCCAGAGATGGAGTTTGCATGGTCGCCTTGCAGATACCAAGAAAAGGTTGGAGTCCTTGAAGCAGGGAATGGAGACCAGGAAAACGGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

162

Amino Acids

18.21

Weight (kDa)

5.08

Isoelectric Point (pI)

69.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7803 PF25086 1 - 160 5.3e-93 Domain of unknown function (DUF7803)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 239
AcyI GRCGYC 1 cut(s) 333
AfiI CCNNNNNNNGG 1 cut(s) 438
AgsI TTSAA 1 cut(s) 454
AjnI CCWGG 1 cut(s) 470
AluBI AGCT 3 cut(s) 199, 314, 322
AluI AGCT 3 cut(s) 199, 314, 322
Alw26I GTCTC 1 cut(s) 461
AoxI GGCC 1 cut(s) 64
ArsI GACNNNNNNTTYG 2 cut(s) 318, 350
AspLEI GCGC 2 cut(s) 221, 354
AspS9I GGNCC 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 66
BbsI GAAGAC 1 cut(s) 253
BccI CCATC 3 cut(s) 79, 125, 396
BciT130I CCWGG 1 cut(s) 472
BcoDI GTCTC 1 cut(s) 461
BfaI CTAG 1 cut(s) 366
BfoI RGCGCY 1 cut(s) 355
Bme1390I CCNGG 1 cut(s) 472
BmgT120I GGNCC 1 cut(s) 65
BmrFI CCNGG 1 cut(s) 472
BpiI GAAGAC 1 cut(s) 253
BsaHI GRCGYC 1 cut(s) 333
BsaI GGTCTC 1 cut(s) 461
Bsc4I CCNNNNNNNGG 1 cut(s) 438
BseBI CCWGG 1 cut(s) 472
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 438
BseMII CTCAG 1 cut(s) 332
BshFI GGCC 1 cut(s) 66
BslI CCNNNNNNNGG 1 cut(s) 438
BsmAI GTCTC 1 cut(s) 461
BsnI GGCC 1 cut(s) 66
Bso31I GGTCTC 1 cut(s) 461
BspANI GGCC 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 331
BspTNI GGTCTC 1 cut(s) 461
BssNI GRCGYC 1 cut(s) 333
Bst2UI CCWGG 1 cut(s) 472
Bst4CI ACNGT 2 cut(s) 216, 263
BstACI GRCGYC 1 cut(s) 333
BstDEI CTNAG 1 cut(s) 318
BstF5I GGATG 1 cut(s) 10
BstH2I RGCGCY 1 cut(s) 355
BstHHI GCGC 2 cut(s) 221, 354
BstMAI GTCTC 1 cut(s) 461
BstNI CCWGG 1 cut(s) 472
BstSCI CCNGG 1 cut(s) 470
BstV2I GAAGAC 1 cut(s) 253
BsuRI GGCC 1 cut(s) 66
BtgZI GCGATG 1 cut(s) 63
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 2 cut(s) 221, 268
CfoI GCGC 2 cut(s) 221, 354
Cfr13I GGNCC 1 cut(s) 65
CseI GACGC 1 cut(s) 322
CviAII CATG 2 cut(s) 104, 413
CviJI RGCY 6 cut(s) 19, 66, 181, 199, 314, 322
CviKI_1 RGCY 6 cut(s) 19, 66, 181, 199, 314, 322
DdeI CTNAG 1 cut(s) 318
DraI TTTAAA 1 cut(s) 294
Eco31I GGTCTC 1 cut(s) 461
Eco57I CTGAAG 1 cut(s) 239
EcoRII CCWGG 1 cut(s) 470
FaeI CATG 2 cut(s) 107, 416
FaiI YATR 6 cut(s) 26, 105, 206, 210, 383, 414
FalI AAGNNNNNCTT 2 cut(s) 183, 215
FatI CATG 2 cut(s) 103, 412
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 366
GlaI GCGC 2 cut(s) 220, 353
HaeII RGCGCY 1 cut(s) 355
HaeIII GGCC 1 cut(s) 66
HgaI GACGC 1 cut(s) 322
HhaI GCGC 2 cut(s) 221, 354
Hin1I GRCGYC 1 cut(s) 333
Hin1II CATG 2 cut(s) 107, 416
Hin6I GCGC 2 cut(s) 219, 352
HinP1I GCGC 2 cut(s) 219, 352
HincII GTYRAC 1 cut(s) 121
HindII GTYRAC 1 cut(s) 121
HinfI GANTC 5 cut(s) 11, 145, 358, 372, 446
HphI GGTGA 1 cut(s) 66
Hpy166II GTNNAC 2 cut(s) 121, 371
Hpy188III TCNNGA 2 cut(s) 191, 257
Hpy8I GTNNAC 2 cut(s) 121, 371
HpyAV CCTTC 2 cut(s) 107, 371
HpyCH4III ACNGT 2 cut(s) 216, 263
HpyCH4V TGCA 4 cut(s) 163, 270, 412, 425
HpyF3I CTNAG 1 cut(s) 318
Hsp92I GRCGYC 1 cut(s) 333
Hsp92II CATG 2 cut(s) 107, 416
HspAI GCGC 2 cut(s) 219, 352
LpnPI CCDG 8 cut(s) 48, 68, 95, 102, 242, 410, 443, 457
MaeI CTAG 1 cut(s) 366
MaeIII GTNAC 1 cut(s) 334
MboII GAAGA 1 cut(s) 258
MluCI AATT 3 cut(s) 78, 93, 272
MlyI GAGTC 2 cut(s) 366, 455
MmeI TCCRAC 1 cut(s) 423
MnlI CCTC 2 cut(s) 22, 135
MseI TTAA 1 cut(s) 293
MspR9I CCNGG 1 cut(s) 472
MvaI CCWGG 1 cut(s) 472
NlaIII CATG 2 cut(s) 107, 416
NmuCI GTSAC 1 cut(s) 334
PcsI WCGNNNNNNNCGW 1 cut(s) 330
PfeI GAWTC 3 cut(s) 11, 145, 358
PleI GAGTC 2 cut(s) 366, 454
PpsI GAGTC 2 cut(s) 366, 454
Psp6I CCWGG 1 cut(s) 470
PspGI CCWGG 1 cut(s) 470
PspPI GGNCC 1 cut(s) 65
SaqAI TTAA 1 cut(s) 293
Sau96I GGNCC 1 cut(s) 65
SchI GAGTC 2 cut(s) 366, 455
ScrFI CCNGG 1 cut(s) 472
SetI ASST 6 cut(s) 57, 118, 201, 316, 324, 443
Sse9I AATT 3 cut(s) 78, 93, 272
SspMI CTAG 1 cut(s) 366
StyD4I CCNGG 1 cut(s) 470
TaaI ACNGT 2 cut(s) 216, 263
TaqI TCGA 2 cut(s) 324, 375
TasI AATT 3 cut(s) 78, 93, 272
TfiI GAWTC 3 cut(s) 11, 145, 358
Tru1I TTAA 1 cut(s) 293
Tru9I TTAA 1 cut(s) 293
TscAI CASTG 2 cut(s) 221, 268
TseFI GTSAC 1 cut(s) 334
Tsp45I GTSAC 1 cut(s) 334
TspDTI ATGAA 1 cut(s) 312
TspGWI ACGGA 1 cut(s) 402
TspRI CASTG 2 cut(s) 221, 268
XcmI CCANNNNNNNNNTGG 1 cut(s) 439
XspI CTAG 1 cut(s) 366
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.