pycom03g13620

ERG2 and Sigma1 receptor like protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Reverse (-)
14743906 .. 14744103
198 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g13620.1

Sequence Viewer

Length: 198 bp
ATGGAGAGAAAATGGGGTTTTGGGTGTGAGTTTTGGAGATTGATTTTGGGTTTAAGCTTGGTTTATGTGGCGATGTGCGGGTTTTATAAGATGGTTTCGGGTGCATTGAAACCAATTCTATCGCCGGAGATGGTGAGAAATGTTAGTGAAAAATCTTGGGTTGTGGATGATATGAATGGCAGGCTAAGGTTCTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.56

Weight (kDa)

9.18

Isoelectric Point (pI)

30.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011384)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 87
AciI CCGC 1 cut(s) 78
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 145
BccI CCATC 2 cut(s) 85, 124
Bpu10I CCTNAGC 1 cut(s) 185
BseGI GGATG 1 cut(s) 172
BsiSI CCGG 1 cut(s) 125
BspACI CCGC 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 185
BstF5I GGATG 1 cut(s) 172
BtgZI GCGATG 1 cut(s) 86
BtsCI GGATG 1 cut(s) 172
Cac8I GCNNGC 1 cut(s) 182
CviJI RGCY 2 cut(s) 57, 184
CviKI_1 RGCY 2 cut(s) 57, 184
DdeI CTNAG 1 cut(s) 185
FaiI YATR 3 cut(s) 66, 87, 173
FauI CCCGC 1 cut(s) 71
FokI GGATG 1 cut(s) 179
HapII CCGG 1 cut(s) 125
HindIII AAGCTT 1 cut(s) 55
HpaII CCGG 1 cut(s) 125
HphI GGTGA 1 cut(s) 145
HpyCH4V TGCA 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 185
LpnPI CCDG 2 cut(s) 138, 166
MluCI AATT 1 cut(s) 114
MseI TTAA 1 cut(s) 53
MspI CCGG 1 cut(s) 125
PsiI TTATAA 1 cut(s) 87
SaqAI TTAA 1 cut(s) 53
SetI ASST 2 cut(s) 59, 191
SgeI CNNG 6 cut(s) 70, 91, 111, 137, 168, 193
Sse9I AATT 1 cut(s) 114
SsiI CCGC 1 cut(s) 78
TasI AATT 1 cut(s) 114
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TspDTI ATGAA 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.