pycom04g11620

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
14486345 .. 14487216
872 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g11620.2

Sequence Viewer

Length: 282 bp
ATGTTCTTATTTTATTCTTGGGTTAGAGCATGCATGTATTATCAGTTGCTAGATGTCATGATCGATCCCTGTATTATATGTGAAATAAAAAAAGAAGGAACACTCTATAACTCTAATCAGATGTCCACTGAAAAGAAGACAAATCACATTATAGACCAATACGTGTTAAAATTATTATACGAACATAAAAAAAAAGCCTCCAAACCTCCAAAGACAGTAGCAAGATCTTTGTTGATGTGCTCTGGTAGAAATTACAGAGGAGCTTATTTGTTGGAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.99

Weight (kDa)

9.21

Isoelectric Point (pI)

37.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AflIII ACRYGT 1 cut(s) 162
AluBI AGCT 1 cut(s) 263
AluI AGCT 1 cut(s) 263
Alw21I GWGCWC 1 cut(s) 242
AlwI GGATC 1 cut(s) 59
BbsI GAAGAC 1 cut(s) 143
Bbv12I GWGCWC 1 cut(s) 242
BfaI CTAG 1 cut(s) 50
BglII AGATCT 1 cut(s) 224
BpiI GAAGAC 1 cut(s) 143
Bsa29I ATCGAT 1 cut(s) 63
BsaAI YACGTR 1 cut(s) 163
BseCI ATCGAT 1 cut(s) 63
BseRI GAGGAG 1 cut(s) 273
BshVI ATCGAT 1 cut(s) 63
BsiHKAI GWGCWC 1 cut(s) 242
Bsp1286I GDGCHC 1 cut(s) 242
Bsp143I GATC 3 cut(s) 60, 64, 224
BspDI ATCGAT 1 cut(s) 63
BspHI TCATGA 1 cut(s) 57
BspPI GGATC 1 cut(s) 59
BssMI GATC 3 cut(s) 60, 64, 224
Bst4CI ACNGT 1 cut(s) 217
BstBAI YACGTR 1 cut(s) 163
BstC8I GCNNGC 1 cut(s) 31
BstKTI GATC 3 cut(s) 63, 67, 227
BstMBI GATC 3 cut(s) 60, 64, 224
BstNSI RCATGY 2 cut(s) 33, 37
BstV2I GAAGAC 1 cut(s) 143
BstX2I RGATCY 1 cut(s) 224
BstYI RGATCY 1 cut(s) 224
Bsu15I ATCGAT 1 cut(s) 63
BsuTUI ATCGAT 1 cut(s) 63
BtsIMutI CAGTG 1 cut(s) 126
Cac8I GCNNGC 1 cut(s) 31
CciI TCATGA 1 cut(s) 57
ClaI ATCGAT 1 cut(s) 63
CviAII CATG 3 cut(s) 30, 34, 58
CviJI RGCY 2 cut(s) 197, 263
CviKI_1 RGCY 2 cut(s) 197, 263
DpnI GATC 3 cut(s) 62, 66, 226
DpnII GATC 3 cut(s) 60, 64, 224
EcoT22I ATGCAT 1 cut(s) 35
FaeI CATG 3 cut(s) 33, 37, 61
FaiI YATR 9 cut(s) 31, 35, 59, 77, 79, 108, 152, 178, 186
FatI CATG 3 cut(s) 29, 33, 57
FspBI CTAG 1 cut(s) 50
Hin1II CATG 3 cut(s) 33, 37, 61
Hpy166II GTNNAC 1 cut(s) 126
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 58
Hpy8I GTNNAC 1 cut(s) 126
HpyAV CCTTC 1 cut(s) 89
HpyCH4III ACNGT 1 cut(s) 217
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 162
Hsp92II CATG 3 cut(s) 33, 37, 61
Kzo9I GATC 3 cut(s) 60, 64, 224
LmnI GCTCC 1 cut(s) 260
LpnPI CCDG 2 cut(s) 82, 228
MaeI CTAG 1 cut(s) 50
MaeII ACGT 1 cut(s) 162
MalI GATC 3 cut(s) 62, 66, 226
MboI GATC 3 cut(s) 60, 64, 224
MboII GAAGA 1 cut(s) 148
MflI RGATCY 1 cut(s) 224
MhlI GDGCHC 1 cut(s) 242
MluCI AATT 2 cut(s) 170, 250
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 3 cut(s) 208, 216, 251
Mph1103I ATGCAT 1 cut(s) 35
MseI TTAA 1 cut(s) 167
NdeII GATC 3 cut(s) 60, 64, 224
NlaIII CATG 3 cut(s) 33, 37, 61
NsiI ATGCAT 1 cut(s) 35
NspI RCATGY 2 cut(s) 33, 37
PaeI GCATGC 1 cut(s) 33
PagI TCATGA 1 cut(s) 57
Ppu21I YACGTR 1 cut(s) 163
PsuI RGATCY 1 cut(s) 224
SaqAI TTAA 1 cut(s) 167
Sau3AI GATC 3 cut(s) 60, 64, 224
SduI GDGCHC 1 cut(s) 242
SetI ASST 3 cut(s) 165, 208, 265
SgeI CNNG 9 cut(s) 30, 42, 46, 62, 70, 81, 175, 234, 255
SphI GCATGC 1 cut(s) 33
Sse9I AATT 2 cut(s) 170, 250
SspMI CTAG 1 cut(s) 50
TaaI ACNGT 1 cut(s) 217
TaiI ACGT 1 cut(s) 165
TaqI TCGA 1 cut(s) 63
TasI AATT 2 cut(s) 170, 250
Tru1I TTAA 1 cut(s) 167
Tru9I TTAA 1 cut(s) 167
TscAI CASTG 1 cut(s) 133
TspRI CASTG 1 cut(s) 133
XceI RCATGY 2 cut(s) 33, 37
XspI CTAG 1 cut(s) 50
Zsp2I ATGCAT 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.