Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr5

Orthogroup ID

OG0003676

Physical Location & Seq

Genomic Coordinates Forward (+)

175195 .. 180163

Gene Structure 4969 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom05g00150.9

Sequence Viewer

CDS Protein Promoter (2k)

Length: 852 bp

ATGGAGGAATACTTGCAGTACATGAAGACGTTGCGCTCTCAGATGAACGATGTGGAAGATCAAGCTGCAAAGGTCTCAGTGGAAGAGCAAATGCAGTTGACCACCATTCAGACATTGGTGAACGATCTCAATTCTGCAATATCAGAAACAAAACGATTCATGGAAGACATTGAGCAGATGAAAAATGCGAAAGGTCAAGTATGCTCGCTAATTTTGGAAAAGCAGAGAAAGATGGCTTCTTTGGAGTCTGATTCGTCCACACTGATCCAGACTCTGGAGCTTATTGAACAAGAAAGAATCAACTTATCTTCCAAGCTTATAGAAAAGAGCACTCACTACGTGAAGGTTAGAGAGGATGTCAATGCCAAATTGCAGCAGCAACAGGAATGGGTCTATTCTCACTGCACTCACATGGAACTGGGAGAGCATGGAATGGTTAAGGATAGATTTGATGAGAAAAGAGGTGAGTTTCAAGGGAAGGCTAGTTTTGATAACCACCTCATCATGGACAACCAGGGCAATGATGCAAGGAAGAACCTAATGAACATGTTGGATTCTGCTAAAGCCAAGCTTGATGAGATTTTACAAATGAACTCTGAACTTGTTATCGAGAACTGCAAGACGAAGCAGGCTATTGAGCAAGTAAATTTGAGGGAAAATGATTTTAAGCCAGAGCTAAGGGCAATGGATATAAAGACCCTGGAAGAAGAATACAGTGCTCTTCTATCAGACAAAGCTGGAGAAACTGAGTACTTGAAGACTCTGCAGGACCAAATTGAGAAACTGAGGGTAAACTGTTTATCGGGTTTTTCTTTGGTGTTTACAGATTTACAGAAATTTGTAACCATGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

284

Amino Acids

32.82

Weight (kDa)

4.97

Isoelectric Point (pI)

53.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003676)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G33500 AT1G33500 AT1G33500
fragaria_vesca	FvH4_2g00330 FvH4_2g00330 FvH4_2g00330 FvH4_2g00330 FvH4_2g00330 FvH4_2g00330 FvH4_2g00330 FvH4_2g00330 FvH4_2g00330 FvH4_2g00330 FvH4_2g00330 FvH4_2g04930
malus_domestica	MD05G1006300.v1.1
prunus_persica	Prupe.8G003600_v2.0.a1 Prupe.8G003600_v2.0.a1 Prupe.8G003600_v2.0.a1 Prupe.8G003600_v2.0.a1 Prupe.8G003600_v2.0.a1 Prupe.8G003600_v2.0.a1
pyrus_communis	pycom05g00150 pycom10g00200
rosa_chinensis	RchiOBHm_Chr6g0249621
rosa_laevigata	RLG00000015557
rosa_multiflora	Rmu_sc0006936.1_g000015
rosa_roxburghii	Rroxscaffold_7G00217480
rosa_rugosa	Rorug05G0494200 Rorug05G0494200
rosa_samantha	Rh6AG004000 Rh6BG006200 Rh6CG003000 Rh6DG002800
rosa_wichuraiana	Rw6G000440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	274
AclWI	GGATC	1 cut(s)	259
AcsI	RAATTY	2 cut(s)	646, 836
AdeI	CACNNNGTG	1 cut(s)	340
AfaI	GTAC	2 cut(s)	20, 752
AfiI	CCNNNNNNNGG	2 cut(s)	274, 505
AflIII	ACRYGT	1 cut(s)	546
AgsI	TTSAA	3 cut(s)	287, 473, 757
AjnI	CCWGG	2 cut(s)	513, 699
AluBI	AGCT	6 cut(s)	65, 280, 316, 571, 676, 737
AluI	AGCT	6 cut(s)	65, 280, 316, 571, 676, 737
Alw21I	GWGCWC	2 cut(s)	332, 721
Alw26I	GTCTC	1 cut(s)	79
AlwI	GGATC	1 cut(s)	259
AlwNI	CAGNNNCTG	1 cut(s)	274
ApeKI	GCWGC	3 cut(s)	65, 373, 376
ApoI	RAATTY	2 cut(s)	646, 836
AspLEI	GCGC	1 cut(s)	36
AspS9I	GGNCC	1 cut(s)	769
AsuHPI	GGTGA	2 cut(s)	130, 476
AvaII	GGWCC	1 cut(s)	769
BbsI	GAAGAC	3 cut(s)	32, 171, 764
Bbv12I	GWGCWC	2 cut(s)	332, 721
BbvI	GCAGC	3 cut(s)	52, 385, 388
BccI	CCATC	1 cut(s)	226
BciT130I	CCWGG	2 cut(s)	515, 701
BcoDI	GTCTC	1 cut(s)	79
BfaI	CTAG	1 cut(s)	483
BfmI	CTRYAG	1 cut(s)	764
BisI	GCNGC	3 cut(s)	66, 374, 377
BlsI	GCNGC	3 cut(s)	67, 375, 378
BmcAI	AGTACT	1 cut(s)	752
Bme1390I	CCNGG	2 cut(s)	515, 701
Bme18I	GGWCC	1 cut(s)	769
BmgT120I	GGNCC	1 cut(s)	769
BmrFI	CCNGG	2 cut(s)	515, 701
BmrI	ACTGGG	1 cut(s)	428
BmsI	GCATC	1 cut(s)	514
BmuI	ACTGGG	1 cut(s)	428
BpiI	GAAGAC	3 cut(s)	32, 171, 764
BpmI	CTGGAG	2 cut(s)	296, 759
Bpu10I	CCTNAGC	1 cut(s)	677
BsaAI	YACGTR	1 cut(s)	340
BsaI	GGTCTC	1 cut(s)	79
BsaJI	CCNNGG	2 cut(s)	514, 699
Bsc4I	CCNNNNNNNGG	2 cut(s)	274, 505
Bse1I	ACTGG	1 cut(s)	423
Bse3DI	GCAATG	2 cut(s)	526, 690
BseBI	CCWGG	2 cut(s)	515, 701
BseDI	CCNNGG	2 cut(s)	514, 699
BseGI	GGATG	1 cut(s)	361
BseLI	CCNNNNNNNGG	2 cut(s)	274, 505
BseMI	GCAATG	2 cut(s)	526, 690
BseMII	CTCAG	4 cut(s)	53, 90, 738, 776
BseNI	ACTGG	1 cut(s)	423
BseXI	GCAGC	3 cut(s)	52, 385, 388
BsgI	GTGCAG	1 cut(s)	388
BsiHKAI	GWGCWC	2 cut(s)	332, 721
BslI	CCNNNNNNNGG	2 cut(s)	274, 505
BsmAI	GTCTC	1 cut(s)	79
Bso31I	GGTCTC	1 cut(s)	79
Bsp1286I	GDGCHC	2 cut(s)	332, 721
Bsp143I	GATC	3 cut(s)	58, 124, 264
BspCNI	CTCAG	4 cut(s)	52, 89, 739, 777
BspMAI	CTGCAG	1 cut(s)	768
BspPI	GGATC	1 cut(s)	259
BspQI	GCTCTTC	2 cut(s)	78, 726
BspTNI	GGTCTC	1 cut(s)	79
BsrDI	GCAATG	2 cut(s)	526, 690
BsrI	ACTGG	1 cut(s)	423
BssECI	CCNNGG	2 cut(s)	514, 699
BssMI	GATC	3 cut(s)	58, 124, 264
Bst2UI	CCWGG	2 cut(s)	515, 701
Bst4CI	ACNGT	2 cut(s)	716, 797
Bst6I	CTCTTC	2 cut(s)	78, 726
BstBAI	YACGTR	1 cut(s)	340
BstC8I	GCNNGC	2 cut(s)	206, 630
BstDEI	CTNAG	5 cut(s)	39, 76, 677, 747, 785
BstF5I	GGATG	1 cut(s)	361
BstHHI	GCGC	1 cut(s)	36
BstKTI	GATC	3 cut(s)	61, 127, 267
BstMAI	GTCTC	1 cut(s)	79
BstMBI	GATC	3 cut(s)	58, 124, 264
BstNI	CCWGG	2 cut(s)	515, 701
BstNSI	RCATGY	1 cut(s)	550
BstSCI	CCNGG	2 cut(s)	513, 699
BstSFI	CTRYAG	1 cut(s)	764
BstV1I	GCAGC	3 cut(s)	52, 385, 388
BstV2I	GAAGAC	3 cut(s)	32, 171, 764
BtsCI	GGATG	1 cut(s)	361
BtsI	GCAGTG	1 cut(s)	400
BtsIMutI	CAGTG	4 cut(s)	84, 260, 400, 721
Cac8I	GCNNGC	2 cut(s)	206, 630
CaiI	CAGNNNCTG	1 cut(s)	274
CfoI	GCGC	1 cut(s)	36
Cfr13I	GGNCC	1 cut(s)	769
Csp6I	GTAC	2 cut(s)	19, 751
CviAII	CATG	7 cut(s)	22, 160, 412, 428, 505, 547, 847
CviQI	GTAC	2 cut(s)	19, 751
DdeI	CTNAG	5 cut(s)	39, 76, 677, 747, 785
DpnI	GATC	3 cut(s)	60, 126, 266
DpnII	GATC	3 cut(s)	58, 124, 264
DraIII	CACNNNGTG	1 cut(s)	340
Eam1104I	CTCTTC	2 cut(s)	78, 726
EarI	CTCTTC	2 cut(s)	78, 726
Eco31I	GGTCTC	1 cut(s)	79
Eco47I	GGWCC	1 cut(s)	769
EcoRII	CCWGG	2 cut(s)	513, 699
FaeI	CATG	7 cut(s)	25, 163, 415, 431, 508, 550, 850
FalI	AAGNNNNNCTT	2 cut(s)	555, 587
FatI	CATG	7 cut(s)	21, 159, 411, 427, 504, 546, 846
Fnu4HI	GCNGC	3 cut(s)	66, 374, 377
FokI	GGATG	1 cut(s)	368
Fsp4HI	GCNGC	3 cut(s)	66, 374, 377
FspBI	CTAG	1 cut(s)	483
GlaI	GCGC	1 cut(s)	35
GluI	GCNGC	3 cut(s)	66, 374, 377
GsuI	CTGGAG	2 cut(s)	296, 759
HhaI	GCGC	1 cut(s)	36
Hin1II	CATG	7 cut(s)	25, 163, 415, 431, 508, 550, 850
Hin6I	GCGC	1 cut(s)	34
HinP1I	GCGC	1 cut(s)	34
HincII	GTYRAC	1 cut(s)	99
HindII	GTYRAC	1 cut(s)	99
HindIII	AAGCTT	2 cut(s)	314, 569
HinfI	GANTC	7 cut(s)	156, 245, 251, 271, 297, 554, 760
HphI	GGTGA	2 cut(s)	130, 476
Hpy166II	GTNNAC	5 cut(s)	99, 121, 258, 793, 822
Hpy188I	TCNGA	6 cut(s)	42, 111, 145, 250, 598, 730
Hpy188III	TCNNGA	3 cut(s)	268, 275, 610
Hpy8I	GTNNAC	5 cut(s)	99, 121, 258, 793, 822
HpyAV	CCTTC	2 cut(s)	337, 472
HpyCH4III	ACNGT	2 cut(s)	716, 797
HpyCH4IV	ACGT	2 cut(s)	29, 339
HpyCH4V	TGCA	9 cut(s)	16, 68, 94, 137, 373, 405, 527, 618, 766
HpyF3I	CTNAG	5 cut(s)	39, 76, 677, 747, 785
HpySE526I	ACGT	2 cut(s)	29, 339
Hsp92II	CATG	7 cut(s)	25, 163, 415, 431, 508, 550, 850
HspAI	GCGC	1 cut(s)	34
Kzo9I	GATC	3 cut(s)	58, 124, 264
LguI	GCTCTTC	2 cut(s)	78, 726
LmnI	GCTCC	1 cut(s)	277
Lsp1109I	GCAGC	3 cut(s)	52, 385, 388
LweI	GCATC	1 cut(s)	514
MaeI	CTAG	1 cut(s)	483
MaeII	ACGT	2 cut(s)	29, 339
MaeIII	GTNAC	1 cut(s)	841
MalI	GATC	3 cut(s)	60, 126, 266
MboI	GATC	3 cut(s)	58, 124, 264
MhlI	GDGCHC	2 cut(s)	332, 721
MluCI	AATT	6 cut(s)	130, 210, 368, 646, 774, 836
MlyI	GAGTC	3 cut(s)	254, 265, 754
MmeI	TCCRAC	1 cut(s)	531
MnlI	CCTC	5 cut(s)	346, 455, 509, 645, 780
MseI	TTAA	2 cut(s)	438, 666
MslI	CAYNNNNRTG	1 cut(s)	410
MspR9I	CCNGG	2 cut(s)	515, 701
MvaI	CCWGG	2 cut(s)	515, 701
NdeII	GATC	3 cut(s)	58, 124, 264
NlaIII	CATG	7 cut(s)	25, 163, 415, 431, 508, 550, 850
NspI	RCATGY	1 cut(s)	550
PciI	ACATGT	1 cut(s)	546
PciSI	GCTCTTC	2 cut(s)	78, 726
PfeI	GAWTC	4 cut(s)	156, 251, 297, 554
PflMI	CCANNNNNTGG	1 cut(s)	274
PkrI	GCNGC	3 cut(s)	67, 375, 378
PleI	GAGTC	3 cut(s)	253, 265, 754
PpsI	GAGTC	3 cut(s)	253, 265, 754
Ppu21I	YACGTR	1 cut(s)	340
PscI	ACATGT	1 cut(s)	546
Psp6I	CCWGG	2 cut(s)	513, 699
PspGI	CCWGG	2 cut(s)	513, 699
PspPI	GGNCC	1 cut(s)	769
PstI	CTGCAG	1 cut(s)	768
PstNI	CAGNNNCTG	1 cut(s)	274
RsaI	GTAC	2 cut(s)	20, 752
RsaNI	GTAC	2 cut(s)	19, 751
RseI	CAYNNNNRTG	1 cut(s)	410
SapI	GCTCTTC	2 cut(s)	78, 726
SaqAI	TTAA	2 cut(s)	438, 666
SatI	GCNGC	3 cut(s)	66, 374, 377
Sau3AI	GATC	3 cut(s)	58, 124, 264
Sau96I	GGNCC	1 cut(s)	769
ScaI	AGTACT	1 cut(s)	752
SchI	GAGTC	3 cut(s)	254, 265, 754
ScrFI	CCNGG	2 cut(s)	515, 701
SduI	GDGCHC	2 cut(s)	332, 721
SfaNI	GCATC	1 cut(s)	514
SfcI	CTRYAG	1 cut(s)	764
SinI	GGWCC	1 cut(s)	769
SmiMI	CAYNNNNRTG	1 cut(s)	410
Sse9I	AATT	6 cut(s)	130, 210, 368, 646, 774, 836
SspMI	CTAG	1 cut(s)	483
StyD4I	CCNGG	2 cut(s)	513, 699
TaaI	ACNGT	2 cut(s)	716, 797
TaiI	ACGT	2 cut(s)	32, 342
TaqI	TCGA	1 cut(s)	609
TasI	AATT	6 cut(s)	130, 210, 368, 646, 774, 836
TatI	WGTACW	2 cut(s)	18, 750
TfiI	GAWTC	4 cut(s)	156, 251, 297, 554
Tru1I	TTAA	2 cut(s)	438, 666
Tru9I	TTAA	2 cut(s)	438, 666
TscAI	CASTG	4 cut(s)	84, 267, 407, 721
TseI	GCWGC	3 cut(s)	65, 373, 376
TspDTI	ATGAA	6 cut(s)	38, 59, 148, 194, 557, 605
TspRI	CASTG	4 cut(s)	84, 267, 407, 721
Van91I	CCANNNNNTGG	1 cut(s)	274
VpaK11BI	GGWCC	1 cut(s)	769
XapI	RAATTY	2 cut(s)	646, 836
XceI	RCATGY	1 cut(s)	550
XcmI	CCANNNNNNNNNTGG	1 cut(s)	112
XspI	CTAG	1 cut(s)	483
ZrmI	AGTACT	1 cut(s)	752

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.