Rmu_sc0006936.1_g000015

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006936.1
OG0003676
Physical Location & Seq
Forward (+)
57081 .. 60958
3878 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006936.1_g000015.1.cds

Sequence Viewer

Length: 504 bp
atggaagacattgagcagatgaagaatgctaagggtcaagtatgctcagagattctggaaagacagagaaagatactttgtttggagtcagattcatccacccttatccaggattggattagtggtcaccagactactacagaacttggagaacctggaatggacaatgatgcaagaaagaacctaatggcgatggttgactctgctaaagtcaagcttgatgagattctacgaatgaaagctgaacttatcggagagaattacaagacgaagcaggctattgagcaactaaattgcagggaaaatgattttaagccagagctaagggcattggacataaagaccctggaggacgaatacagtgcccttttatcagataaagctggagaaactgaatacttgaagtctctgcaggaccaaattgataaaataaagggtatatctcatgtgcttaaatgtgcttgcggagaggaatacaaagtggaactggactcttgtgtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

167

Amino Acids

18.96

Weight (kDa)

4.75

Isoelectric Point (pI)

41.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 465
AfiI CCNNNNNNNGG 1 cut(s) 109
AgsI TTSAA 1 cut(s) 403
AjnI CCWGG 3 cut(s) 108, 154, 345
AluBI AGCT 4 cut(s) 217, 242, 322, 383
AluI AGCT 4 cut(s) 217, 242, 322, 383
Alw26I GTCTC 1 cut(s) 411
AspS9I GGNCC 1 cut(s) 415
AsuHPI GGTGA 1 cut(s) 119
AvaII GGWCC 1 cut(s) 415
BaeGI GKGCMC 1 cut(s) 367
BbsI GAAGAC 1 cut(s) 12
BccI CCATC 1 cut(s) 187
BcgI CGANNNNNNTGC 2 cut(s) 344, 378
BciT130I CCWGG 3 cut(s) 110, 156, 347
BcoDI GTCTC 1 cut(s) 411
BfmI CTRYAG 2 cut(s) 138, 410
Bme1390I CCNGG 3 cut(s) 110, 156, 347
Bme18I GGWCC 1 cut(s) 415
BmgT120I GGNCC 1 cut(s) 415
BmrFI CCNGG 3 cut(s) 110, 156, 347
BmsI GCATC 1 cut(s) 160
BpiI GAAGAC 1 cut(s) 12
BpmI CTGGAG 2 cut(s) 368, 405
Bpu10I CCTNAGC 2 cut(s) 30, 323
BsaJI CCNNGG 1 cut(s) 345
Bsc4I CCNNNNNNNGG 1 cut(s) 109
Bse1I ACTGG 1 cut(s) 492
BseBI CCWGG 3 cut(s) 110, 156, 347
BseDI CCNNGG 1 cut(s) 345
BseGI GGATG 1 cut(s) 95
BseLI CCNNNNNNNGG 1 cut(s) 109
BseMII CTCAG 1 cut(s) 60
BseNI ACTGG 1 cut(s) 492
BseSI GKGCMC 1 cut(s) 367
BslI CCNNNNNNNGG 1 cut(s) 109
BsmAI GTCTC 1 cut(s) 411
BsmI GAATGC 1 cut(s) 31
Bsp1286I GDGCHC 1 cut(s) 367
BspACI CCGC 1 cut(s) 465
BspCNI CTCAG 1 cut(s) 59
BspMAI CTGCAG 1 cut(s) 414
BsrI ACTGG 1 cut(s) 492
BssECI CCNNGG 1 cut(s) 345
Bst2UI CCWGG 3 cut(s) 110, 156, 347
Bst4CI ACNGT 1 cut(s) 362
BstC8I GCNNGC 2 cut(s) 276, 463
BstDEI CTNAG 3 cut(s) 30, 46, 323
BstEII GGTNACC 1 cut(s) 125
BstENI CCTNNNNNAGG 1 cut(s) 107
BstF5I GGATG 1 cut(s) 95
BstMAI GTCTC 1 cut(s) 411
BstNI CCWGG 3 cut(s) 110, 156, 347
BstPI GGTNACC 1 cut(s) 125
BstSCI CCNGG 3 cut(s) 108, 154, 345
BstSFI CTRYAG 2 cut(s) 138, 410
BstSLI GKGCMC 1 cut(s) 367
BstV2I GAAGAC 1 cut(s) 12
BtgZI GCGATG 1 cut(s) 206
BtsCI GGATG 1 cut(s) 95
BtsIMutI CAGTG 1 cut(s) 367
Cac8I GCNNGC 2 cut(s) 276, 463
Cfr13I GGNCC 1 cut(s) 415
CviAII CATG 1 cut(s) 446
CviJI RGCY 6 cut(s) 217, 242, 278, 316, 322, 383
CviKI_1 RGCY 6 cut(s) 217, 242, 278, 316, 322, 383
DdeI CTNAG 3 cut(s) 30, 46, 323
Eco47I GGWCC 1 cut(s) 415
Eco91I GGTNACC 1 cut(s) 125
EcoNI CCTNNNNNAGG 1 cut(s) 107
EcoO65I GGTNACC 1 cut(s) 125
EcoRII CCWGG 3 cut(s) 108, 154, 345
FaeI CATG 1 cut(s) 449
FaiI YATR 5 cut(s) 43, 338, 440, 447, 502
FalI AAGNNNNNCTT 4 cut(s) 201, 233, 231, 263
FatI CATG 1 cut(s) 445
FokI GGATG 1 cut(s) 82
GsuI CTGGAG 2 cut(s) 368, 405
Hin1II CATG 1 cut(s) 449
HincII GTYRAC 1 cut(s) 199
HindII GTYRAC 1 cut(s) 199
HindIII AAGCTT 1 cut(s) 215
HinfI GANTC 6 cut(s) 52, 86, 92, 200, 226, 491
HphI GGTGA 1 cut(s) 119
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 4 cut(s) 49, 91, 254, 376
Hpy188III TCNNGA 1 cut(s) 56
Hpy8I GTNNAC 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 362
HpyCH4V TGCA 3 cut(s) 173, 297, 412
HpyF3I CTNAG 3 cut(s) 30, 46, 323
Hsp92II CATG 1 cut(s) 449
LweI GCATC 1 cut(s) 160
MaeIII GTNAC 1 cut(s) 125
MboII GAAGA 2 cut(s) 17, 34
MhlI GDGCHC 1 cut(s) 367
MluCI AATT 3 cut(s) 259, 292, 420
MlyI GAGTC 3 cut(s) 95, 194, 485
MnlI CCTC 2 cut(s) 343, 463
MseI TTAA 2 cut(s) 312, 453
MspR9I CCNGG 3 cut(s) 110, 156, 347
Mva1269I GAATGC 1 cut(s) 31
MvaI CCWGG 3 cut(s) 110, 156, 347
NlaIII CATG 1 cut(s) 449
NmuCI GTSAC 1 cut(s) 125
PctI GAATGC 1 cut(s) 31
PfeI GAWTC 3 cut(s) 52, 92, 226
PfoI TCCNGGA 1 cut(s) 108
PleI GAGTC 3 cut(s) 94, 194, 485
PpsI GAGTC 3 cut(s) 94, 194, 485
Psp6I CCWGG 3 cut(s) 108, 154, 345
PspEI GGTNACC 1 cut(s) 125
PspGI CCWGG 3 cut(s) 108, 154, 345
PspPI GGNCC 1 cut(s) 415
PstI CTGCAG 1 cut(s) 414
SaqAI TTAA 2 cut(s) 312, 453
Sau96I GGNCC 1 cut(s) 415
SchI GAGTC 3 cut(s) 95, 194, 485
ScrFI CCNGG 3 cut(s) 110, 156, 347
SduI GDGCHC 1 cut(s) 367
SetI ASST 6 cut(s) 157, 186, 219, 244, 324, 385
SfaNI GCATC 1 cut(s) 160
SfcI CTRYAG 2 cut(s) 138, 410
SinI GGWCC 1 cut(s) 415
Sse9I AATT 3 cut(s) 259, 292, 420
SsiI CCGC 1 cut(s) 465
StyD4I CCNGG 3 cut(s) 108, 154, 345
TaaI ACNGT 1 cut(s) 362
TasI AATT 3 cut(s) 259, 292, 420
TfiI GAWTC 3 cut(s) 52, 92, 226
Tru1I TTAA 2 cut(s) 312, 453
Tru9I TTAA 2 cut(s) 312, 453
TscAI CASTG 1 cut(s) 367
TseFI GTSAC 1 cut(s) 125
Tsp45I GTSAC 1 cut(s) 125
TspDTI ATGAA 3 cut(s) 35, 84, 251
TspRI CASTG 1 cut(s) 367
VpaK11BI GGWCC 1 cut(s) 415
XagI CCTNNNNNAGG 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.