pycom06g11550

The RING-variant domain is a C4HC3 zinc-finger like motif found in a number of cellular and viral proteins. Some of these proteins have been shown both in vivo and in vitro to have ubiquitin E3 ligase activity.

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Reverse (-)
16823290 .. 16823758
469 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g11550.2

Sequence Viewer

Length: 360 bp
ATGGGGGGTGAGAAAGAGAGTGAAAATGGAGAGTTACCTGACCTGGAGAAGCAGCAGCTAGGTGGCGGCGGTCCTGAGACTAGCTCACTTCCCAGTTTGGCAACTGTGGATACGGTGCTGCCGCTACAACAGGTTGTCGTTTCGGGTGGGGCGTCATCTGAAGTTCATGAACCGCCGACTGTCACCGCCACGGTCAATTTTTCAGAGGAGGTTCCTTCTCCCAAAAAGGACCACCTGTCGAGGACTTCCAGCTCTCATGAACAATGCAGAGTGTGTCAGCAGGAGAAAGATGAAGTTTTGATTGATCGATCGGATGCCAATGTCGAGGCGGGCTTGCGAAATCCCACAGATCATGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

12.64

Weight (kDa)

4.53

Isoelectric Point (pI)

58.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 6 cut(s) 66, 69, 122, 173, 186, 329
AcuI CTGAAG 1 cut(s) 180
AcyI GRCGYC 1 cut(s) 152
AhdI GACNNNNNGTC 1 cut(s) 235
AjnI CCWGG 1 cut(s) 42
AluBI AGCT 3 cut(s) 58, 84, 252
AluI AGCT 3 cut(s) 58, 84, 252
Alw26I GTCTC 1 cut(s) 71
ApeKI GCWGC 3 cut(s) 52, 55, 118
AspS9I GGNCC 2 cut(s) 71, 229
AsuHPI GGTGA 2 cut(s) 20, 175
AvaII GGWCC 2 cut(s) 71, 229
BbvI GCAGC 3 cut(s) 64, 67, 105
BciT130I CCWGG 1 cut(s) 44
BciVI GTATCC 1 cut(s) 103
BcoDI GTCTC 1 cut(s) 71
BfaI CTAG 2 cut(s) 59, 81
BfuI GTATCC 1 cut(s) 103
BisI GCNGC 5 cut(s) 53, 56, 67, 119, 122
BlsI GCNGC 5 cut(s) 54, 57, 68, 120, 123
Bme1390I CCNGG 1 cut(s) 44
Bme18I GGWCC 2 cut(s) 71, 229
BmeRI GACNNNNNGTC 1 cut(s) 235
BmgT120I GGNCC 2 cut(s) 71, 229
BmiI GGNNCC 1 cut(s) 213
BmrFI CCNGG 1 cut(s) 44
BmrI ACTGGG 1 cut(s) 87
BmsI GCATC 1 cut(s) 304
BmuI ACTGGG 1 cut(s) 87
BplI GAGNNNNNCTC 2 cut(s) 68, 100
BpmI CTGGAG 1 cut(s) 65
Bsa29I ATCGAT 1 cut(s) 307
BsaHI GRCGYC 1 cut(s) 152
BsaJI CCNNGG 1 cut(s) 189
Bse1I ACTGG 1 cut(s) 93
BseBI CCWGG 1 cut(s) 44
BseCI ATCGAT 1 cut(s) 307
BseDI CCNNGG 1 cut(s) 189
BseGI GGATG 1 cut(s) 319
BseMII CTCAG 1 cut(s) 66
BseNI ACTGG 1 cut(s) 93
BseRI GAGGAG 1 cut(s) 221
BseXI GCAGC 3 cut(s) 64, 67, 105
Bsh1285I CGRYCG 1 cut(s) 311
BshVI ATCGAT 1 cut(s) 307
BsiEI CGRYCG 1 cut(s) 311
BsmAI GTCTC 1 cut(s) 71
Bsp143I GATC 3 cut(s) 304, 308, 349
BspACI CCGC 6 cut(s) 66, 69, 122, 173, 186, 329
BspCNI CTCAG 1 cut(s) 67
BspDI ATCGAT 1 cut(s) 307
BspHI TCATGA 2 cut(s) 166, 256
BspLI GGNNCC 1 cut(s) 213
BsrI ACTGG 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 3 cut(s) 304, 308, 349
BssNI GRCGYC 1 cut(s) 152
Bst2UI CCWGG 1 cut(s) 44
Bst4CI ACNGT 4 cut(s) 106, 115, 181, 193
BstACI GRCGYC 1 cut(s) 152
BstC8I GCNNGC 2 cut(s) 331, 335
BstDEI CTNAG 1 cut(s) 75
BstDSI CCRYGG 1 cut(s) 189
BstF5I GGATG 1 cut(s) 319
BstKTI GATC 3 cut(s) 307, 311, 352
BstMAI GTCTC 1 cut(s) 71
BstMBI GATC 3 cut(s) 304, 308, 349
BstMCI CGRYCG 1 cut(s) 311
BstNI CCWGG 1 cut(s) 44
BstSCI CCNGG 1 cut(s) 42
BstV1I GCAGC 3 cut(s) 64, 67, 105
Bsu15I ATCGAT 1 cut(s) 307
BsuI GTATCC 1 cut(s) 103
BsuTUI ATCGAT 1 cut(s) 307
BtgI CCRYGG 1 cut(s) 189
BtsCI GGATG 1 cut(s) 319
Cac8I GCNNGC 2 cut(s) 331, 335
CciI TCATGA 2 cut(s) 166, 256
Cfr13I GGNCC 2 cut(s) 71, 229
ClaI ATCGAT 1 cut(s) 307
CseI GACGC 1 cut(s) 141
CviAII CATG 3 cut(s) 167, 257, 353
CviJI RGCY 4 cut(s) 58, 84, 252, 333
CviKI_1 RGCY 4 cut(s) 58, 84, 252, 333
DdeI CTNAG 1 cut(s) 75
DpnI GATC 3 cut(s) 306, 310, 351
DpnII GATC 3 cut(s) 304, 308, 349
DriI GACNNNNNGTC 1 cut(s) 235
Eam1105I GACNNNNNGTC 1 cut(s) 235
Eco47I GGWCC 2 cut(s) 71, 229
Eco57I CTGAAG 1 cut(s) 180
EcoRII CCWGG 1 cut(s) 42
FaeI CATG 3 cut(s) 170, 260, 356
FaiI YATR 4 cut(s) 168, 258, 354, 358
FatI CATG 3 cut(s) 166, 256, 352
FauI CCCGC 1 cut(s) 322
Fnu4HI GCNGC 5 cut(s) 53, 56, 67, 119, 122
FokI GGATG 1 cut(s) 326
Fsp4HI GCNGC 5 cut(s) 53, 56, 67, 119, 122
FspBI CTAG 2 cut(s) 59, 81
GluI GCNGC 5 cut(s) 53, 56, 67, 119, 122
GsuI CTGGAG 1 cut(s) 65
HgaI GACGC 1 cut(s) 141
Hin1I GRCGYC 1 cut(s) 152
Hin1II CATG 3 cut(s) 170, 260, 356
HphI GGTGA 2 cut(s) 20, 175
Hpy188I TCNGA 3 cut(s) 160, 205, 313
Hpy188III TCNNGA 3 cut(s) 74, 167, 257
HpyAV CCTTC 1 cut(s) 225
HpyCH4III ACNGT 4 cut(s) 106, 115, 181, 193
HpyCH4V TGCA 1 cut(s) 267
HpyF3I CTNAG 1 cut(s) 75
Hsp92I GRCGYC 1 cut(s) 152
Hsp92II CATG 3 cut(s) 170, 260, 356
Kzo9I GATC 3 cut(s) 304, 308, 349
LpnPI CCDG 9 cut(s) 29, 51, 56, 87, 106, 116, 248, 262, 266
Lsp1109I GCAGC 3 cut(s) 64, 67, 105
LweI GCATC 1 cut(s) 304
MaeI CTAG 2 cut(s) 59, 81
MaeIII GTNAC 2 cut(s) 33, 181
MalI GATC 3 cut(s) 306, 310, 351
MboI GATC 3 cut(s) 304, 308, 349
MluCI AATT 1 cut(s) 196
MnlI CCTC 4 cut(s) 199, 202, 234, 319
MspR9I CCNGG 1 cut(s) 44
MvaI CCWGG 1 cut(s) 44
NdeII GATC 3 cut(s) 304, 308, 349
NlaIII CATG 3 cut(s) 170, 260, 356
NlaIV GGNNCC 1 cut(s) 213
NmuCI GTSAC 1 cut(s) 181
PagI TCATGA 2 cut(s) 166, 256
PcsI WCGNNNNNNNCGW 1 cut(s) 149
PkrI GCNGC 5 cut(s) 54, 57, 68, 120, 123
Ple19I CGATCG 1 cut(s) 311
Psp6I CCWGG 1 cut(s) 42
PspGI CCWGG 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 213
PspPI GGNCC 2 cut(s) 71, 229
PvuI CGATCG 1 cut(s) 311
SatI GCNGC 5 cut(s) 53, 56, 67, 119, 122
Sau3AI GATC 3 cut(s) 304, 308, 349
Sau96I GGNCC 2 cut(s) 71, 229
ScrFI CCNGG 1 cut(s) 44
SetI ASST 9 cut(s) 40, 45, 60, 64, 86, 135, 213, 237, 254
SfaNI GCATC 1 cut(s) 304
SinI GGWCC 2 cut(s) 71, 229
Sse9I AATT 1 cut(s) 196
SsiI CCGC 6 cut(s) 66, 69, 122, 173, 186, 329
SspMI CTAG 2 cut(s) 59, 81
StyD4I CCNGG 1 cut(s) 42
TaaI ACNGT 4 cut(s) 106, 115, 181, 193
TaqI TCGA 3 cut(s) 239, 307, 324
TasI AATT 1 cut(s) 196
TauI GCSGC 2 cut(s) 69, 124
TseFI GTSAC 1 cut(s) 181
TseI GCWGC 3 cut(s) 52, 55, 118
Tsp45I GTSAC 1 cut(s) 181
TspDTI ATGAA 4 cut(s) 155, 183, 273, 306
VpaK11BI GGWCC 2 cut(s) 71, 229
XspI CTAG 2 cut(s) 59, 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.