pycom06g20660

Homeobox protein knotted-1-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Forward (+)
23584340 .. 23586517
2178 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g20660.5

Sequence Viewer

Length: 504 bp
ATGATTTGTCTGGGGTTGGAACTTTCGGAAGGTTATAATATGGAAGATGATTTGAGTAGTTCTAGTCACAAGGAGAAGGAAAAAGAAGCAAATATTGAAGATCATGAGATTCTCAAAAAGAAAATCTCTACTCATCCTTTATATGGTTTGTTGATTGAAAATCACTTGGACTGCTTGAAGGTTAGTGGAATCAACGGCGAACTAGAGGCAAATGATGGCTGCGGAGATATGAAACAGCTTGACTACAACTGCAATGCAAATTTAGGCGTGCTTGGACATTCTGACCTCGATCACTTCATGGAAGCATATTGCTTGGCACTTGGGAAGCTGAAAGCAGCAATGGAGGAACCTCGGCAGAAGTCCATGGAGTTCATAACTAACATGCAGTTGCAACTTGAGGATCGATCACAAACAACTCCCATCTACCTGATCAACCTGCACCCGCCTCACTTTCTGGTGAAAGCTAGAGATGACTGTAGCACAAGGGCCATGGGACAAAGATGA

Protein Analysis

168

Amino Acids

18.85

Weight (kDa)

5.1

Isoelectric Point (pI)

35.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 36
Acc36I ACCTGC 1 cut(s) 444
AciI CCGC 2 cut(s) 222, 443
AclWI GGATC 1 cut(s) 408
AcsI RAATTY 1 cut(s) 259
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 3 cut(s) 98, 158, 178
AluBI AGCT 3 cut(s) 238, 328, 464
AluI AGCT 3 cut(s) 238, 328, 464
AlwI GGATC 1 cut(s) 408
AoxI GGCC 1 cut(s) 486
ApeKI GCWGC 2 cut(s) 219, 335
ApoI RAATTY 1 cut(s) 259
AspS9I GGNCC 1 cut(s) 486
AsuHPI GGTGA 1 cut(s) 469
BbvI GCAGC 2 cut(s) 206, 347
BccI CCATC 2 cut(s) 209, 428
BceAI ACGGC 1 cut(s) 211
BclI TGATCA 1 cut(s) 429
BfaI CTAG 3 cut(s) 63, 203, 465
BfmI CTRYAG 1 cut(s) 475
BfuAI ACCTGC 1 cut(s) 444
BisI GCNGC 2 cut(s) 220, 336
BlsI GCNGC 2 cut(s) 221, 337
BmgT120I GGNCC 1 cut(s) 486
BmiI GGNNCC 1 cut(s) 348
BpuEI CTTGAG 1 cut(s) 416
Bsa29I ATCGAT 1 cut(s) 403
BsaJI CCNNGG 3 cut(s) 350, 363, 489
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse3DI GCAATG 2 cut(s) 259, 345
BseCI ATCGAT 1 cut(s) 403
BseDI CCNNGG 3 cut(s) 350, 363, 489
BseGI GGATG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 143
BseMI GCAATG 2 cut(s) 259, 345
BseXI GCAGC 2 cut(s) 206, 347
BsgI GTGCAG 1 cut(s) 422
BshFI GGCC 1 cut(s) 488
BshVI ATCGAT 1 cut(s) 403
BslI CCNNNNNNNGG 1 cut(s) 143
BsnI GGCC 1 cut(s) 488
Bsp143I GATC 5 cut(s) 100, 289, 400, 404, 429
Bsp19I CCATGG 2 cut(s) 363, 489
BspACI CCGC 2 cut(s) 222, 443
BspANI GGCC 1 cut(s) 488
BspDI ATCGAT 1 cut(s) 403
BspHI TCATGA 1 cut(s) 103
BspLI GGNNCC 1 cut(s) 348
BspMI ACCTGC 1 cut(s) 444
BspPI GGATC 1 cut(s) 408
BsrDI GCAATG 2 cut(s) 259, 345
BssECI CCNNGG 3 cut(s) 350, 363, 489
BssMI GATC 5 cut(s) 100, 289, 400, 404, 429
BssT1I CCWWGG 2 cut(s) 363, 489
Bst4CI ACNGT 1 cut(s) 476
BstC8I GCNNGC 1 cut(s) 269
BstDSI CCRYGG 2 cut(s) 363, 489
BstF5I GGATG 1 cut(s) 133
BstKTI GATC 5 cut(s) 103, 292, 403, 407, 432
BstMBI GATC 5 cut(s) 100, 289, 400, 404, 429
BstNSI RCATGY 1 cut(s) 385
BstSFI CTRYAG 1 cut(s) 475
BstV1I GCAGC 2 cut(s) 206, 347
Bsu15I ATCGAT 1 cut(s) 403
BsuRI GGCC 1 cut(s) 488
BsuTUI ATCGAT 1 cut(s) 403
BtgI CCRYGG 2 cut(s) 363, 489
BtsCI GGATG 1 cut(s) 133
BveI ACCTGC 1 cut(s) 444
Cac8I GCNNGC 1 cut(s) 269
CciI TCATGA 1 cut(s) 103
Cfr13I GGNCC 1 cut(s) 486
ClaI ATCGAT 1 cut(s) 403
CviAII CATG 5 cut(s) 104, 298, 364, 382, 490
CviJI RGCY 5 cut(s) 219, 238, 328, 464, 488
CviKI_1 RGCY 5 cut(s) 219, 238, 328, 464, 488
DpnI GATC 5 cut(s) 102, 291, 402, 406, 431
DpnII GATC 5 cut(s) 100, 289, 400, 404, 429
Eco130I CCWWGG 2 cut(s) 363, 489
EcoT14I CCWWGG 2 cut(s) 363, 489
ErhI CCWWGG 2 cut(s) 363, 489
FaeI CATG 5 cut(s) 107, 301, 367, 385, 493
FatI CATG 5 cut(s) 103, 297, 363, 381, 489
FauI CCCGC 1 cut(s) 450
FbaI TGATCA 1 cut(s) 429
Fnu4HI GCNGC 2 cut(s) 220, 336
FokI GGATG 1 cut(s) 120
Fsp4HI GCNGC 2 cut(s) 220, 336
FspBI CTAG 3 cut(s) 63, 203, 465
GluI GCNGC 2 cut(s) 220, 336
HaeIII GGCC 1 cut(s) 488
Hin1II CATG 5 cut(s) 107, 301, 367, 385, 493
HinfI GANTC 2 cut(s) 109, 189
HphI GGTGA 1 cut(s) 469
Hpy188I TCNGA 2 cut(s) 28, 283
Hpy188III TCNNGA 1 cut(s) 104
HpyAV CCTTC 3 cut(s) 23, 70, 172
HpyCH4III ACNGT 1 cut(s) 476
HpyCH4V TGCA 5 cut(s) 252, 257, 385, 391, 439
Hsp92II CATG 5 cut(s) 107, 301, 367, 385, 493
Ksp22I TGATCA 1 cut(s) 429
Kzo9I GATC 5 cut(s) 100, 289, 400, 404, 429
LpnPI CCDG 3 cut(s) 440, 440, 449
Lsp1109I GCAGC 2 cut(s) 206, 347
MaeI CTAG 3 cut(s) 63, 203, 465
MaeIII GTNAC 1 cut(s) 65
MalI GATC 5 cut(s) 102, 291, 402, 406, 431
MboI GATC 5 cut(s) 100, 289, 400, 404, 429
MboII GAAGA 2 cut(s) 56, 110
MluCI AATT 1 cut(s) 259
MnlI CCTC 6 cut(s) 199, 296, 337, 360, 391, 456
NcoI CCATGG 2 cut(s) 363, 489
NdeII GATC 5 cut(s) 100, 289, 400, 404, 429
NlaIII CATG 5 cut(s) 107, 301, 367, 385, 493
NlaIV GGNNCC 1 cut(s) 348
NmeAIII GCCGAG 1 cut(s) 331
NmuCI GTSAC 1 cut(s) 65
NspI RCATGY 1 cut(s) 385
PagI TCATGA 1 cut(s) 103
PfeI GAWTC 2 cut(s) 109, 189
PkrI GCNGC 2 cut(s) 221, 337
PsiI TTATAA 1 cut(s) 36
PspN4I GGNNCC 1 cut(s) 348
PspPI GGNCC 1 cut(s) 486
SatI GCNGC 2 cut(s) 220, 336
Sau3AI GATC 5 cut(s) 100, 289, 400, 404, 429
Sau96I GGNCC 1 cut(s) 486
SetI ASST 9 cut(s) 34, 183, 240, 288, 330, 352, 429, 438, 466
SfcI CTRYAG 1 cut(s) 475
SmlI CTYRAG 1 cut(s) 395
SmoI CTYRAG 1 cut(s) 395
Sse9I AATT 1 cut(s) 259
SsiI CCGC 2 cut(s) 222, 443
SspI AATATT 1 cut(s) 94
SspMI CTAG 3 cut(s) 63, 203, 465
StyI CCWWGG 2 cut(s) 363, 489
TaaI ACNGT 1 cut(s) 476
TaqI TCGA 2 cut(s) 288, 403
TasI AATT 1 cut(s) 259
TfiI GAWTC 2 cut(s) 109, 189
TseFI GTSAC 1 cut(s) 65
TseI GCWGC 2 cut(s) 219, 335
Tsp45I GTSAC 1 cut(s) 65
TspDTI ATGAA 3 cut(s) 245, 286, 361
XapI RAATTY 1 cut(s) 259
XceI RCATGY 1 cut(s) 385
XspI CTAG 3 cut(s) 63, 203, 465
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.