Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8272209.1

Orthogroup ID

OG0002850

Physical Location & Seq

Genomic Coordinates Forward (+)

155 .. 830

Gene Structure 676 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8272209.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 458 bp

atggcggagaatactggtactaatgttagggtggtgacttcttcagatgaacaaggtgatgatcgtattcatgttggccatggggaaggggatgatcaagatgaggacaaggaggaagaagctctaaagaagatgatatcaggtcatccattatatggattgttgcttgagaatcacatcaactgcttgaaggtttgtttgggtgatgaaattggtgcaattacagggagcgctagtactactacttctgttacagaagacactgccaataataagaagctcaaggccgcccttaccaatcctagttcctccgaccttgatcaattcatggaagcatactgcaaagccctaaagaagcttaaagaagccatggacaatcctctaaaggaagcttcatctttcattaactcagcgcatactcagcttgaggagatcaccgaagactccaaggaaaccga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

KNOX1 KNOX2

Protein Analysis

152

Amino Acids

16.5

Weight (kDa)

4.59

Isoelectric Point (pI)

28.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002850)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G14760 AT1G14760 AT1G14760
fragaria_vesca	FvH4_4g33370 FvH4_4g33370 FvH4_5g17670 FvH4_5g17670
malus_domestica	MD06G1232400.v1.1 MD13G1018900.v1.1 MD14G1239200.v1.1
prunus_persica	Prupe.1G335000_v2.0.a1 Prupe.1G335000_v2.0.a1 Prupe.5G236700_v2.0.a1
pyrus_communis	pycom06g20660 pycom14g20010
rosa_chinensis	RchiOBHm_Chr4g0442631 RchiOBHm_Chr7g0177981
rosa_laevigata	RLG00000005445 RLG00000005485 RLG00000005997
rosa_multiflora	Rmu_co8272209.1_g000001
rosa_roxburghii	Rroxscaffold_3G00274890 Rroxscaffold_3G00275330 Rroxscaffold_5G00383430
rosa_rugosa	Rorug04G0341500 Rorug04G0341600 Rorug06G0412000 Rorug06G0412100
rosa_samantha	Rh4AG394200 Rh4BG407200 Rh4CG422600 Rh4DG401200 Rh7AG011400 Rh7BG010900 Rh7BG015300 Rh7CG011500 Rh7DG011400
rosa_wichuraiana	Rw4G034060 Rw7G000920

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	155
AciI	CCGC	2 cut(s)	5, 288
AcoI	YGGCCR	1 cut(s)	76
AcuI	CTGAAG	1 cut(s)	27
AfaI	GTAC	2 cut(s)	19, 238
AfeI	AGCGCT	1 cut(s)	232
AfiI	CCNNNNNNNGG	1 cut(s)	155
AgsI	TTSAA	1 cut(s)	190
AjuI	GAANNNNNNNTTGG	2 cut(s)	182, 214
AluBI	AGCT	5 cut(s)	122, 280, 358, 392, 424
AluI	AGCT	5 cut(s)	122, 280, 358, 392, 424
Aor51HI	AGCGCT	1 cut(s)	232
AoxI	GGCC	2 cut(s)	76, 285
AspLEI	GCGC	2 cut(s)	233, 415
AsuHPI	GGTGA	4 cut(s)	46, 68, 215, 427
BaeI	ACNNNNGTAYC	2 cut(s)	9, 42
BalI	TGGCCA	1 cut(s)	78
BarI	GAAGNNNNNNTAC	2 cut(s)	229, 261
BbsI	GAAGAC	2 cut(s)	264, 447
BclI	TGATCA	2 cut(s)	94, 319
BfaI	CTAG	2 cut(s)	234, 303
BfoI	RGCGCY	1 cut(s)	234
BisI	GCNGC	1 cut(s)	288
BlsI	GCNGC	1 cut(s)	289
BmcAI	AGTACT	1 cut(s)	238
BpiI	GAAGAC	2 cut(s)	264, 447
BpuEI	CTTGAG	3 cut(s)	188, 266, 446
BsaJI	CCNNGG	3 cut(s)	79, 369, 447
BsaXI	ACNNNNNCTCC	2 cut(s)	220, 250
Bsc4I	CCNNNNNNNGG	1 cut(s)	155
Bse1I	ACTGG	1 cut(s)	19
BseDI	CCNNGG	3 cut(s)	79, 369, 447
BseGI	GGATG	2 cut(s)	97, 145
BseLI	CCNNNNNNNGG	1 cut(s)	155
BseMII	CTCAG	2 cut(s)	423, 434
BseNI	ACTGG	1 cut(s)	19
BseRI	GAGGAG	1 cut(s)	443
BshFI	GGCC	2 cut(s)	78, 287
BslI	CCNNNNNNNGG	1 cut(s)	155
BsnI	GGCC	2 cut(s)	78, 287
Bsp143I	GATC	4 cut(s)	61, 94, 319, 432
Bsp19I	CCATGG	2 cut(s)	79, 369
BspACI	CCGC	2 cut(s)	5, 288
BspANI	GGCC	2 cut(s)	78, 287
BspCNI	CTCAG	2 cut(s)	422, 433
BsrI	ACTGG	1 cut(s)	19
BssECI	CCNNGG	3 cut(s)	79, 369, 447
BssMI	GATC	4 cut(s)	61, 94, 319, 432
BssT1I	CCWWGG	3 cut(s)	79, 369, 447
BstDEI	CTNAG	2 cut(s)	409, 420
BstDSI	CCRYGG	2 cut(s)	79, 369
BstF5I	GGATG	2 cut(s)	97, 145
BstH2I	RGCGCY	1 cut(s)	234
BstHHI	GCGC	2 cut(s)	233, 415
BstKTI	GATC	4 cut(s)	64, 97, 322, 435
BstMBI	GATC	4 cut(s)	61, 94, 319, 432
BstMWI	GCNNNNNNNGC	1 cut(s)	421
BstV2I	GAAGAC	2 cut(s)	264, 447
BsuRI	GGCC	2 cut(s)	78, 287
BtgI	CCRYGG	2 cut(s)	79, 369
BtsCI	GGATG	2 cut(s)	97, 145
BtsI	GCAGTG	1 cut(s)	261
BtsIMutI	CAGTG	1 cut(s)	261
CfoI	GCGC	2 cut(s)	233, 415
Csp6I	GTAC	2 cut(s)	18, 237
CviAII	CATG	4 cut(s)	71, 80, 328, 370
CviJI	RGCY	9 cut(s)	78, 122, 280, 287, 347, 358, 368, 392, 424
CviKI_1	RGCY	9 cut(s)	78, 122, 280, 287, 347, 358, 368, 392, 424
CviQI	GTAC	2 cut(s)	18, 237
DdeI	CTNAG	2 cut(s)	409, 420
DpnI	GATC	4 cut(s)	63, 96, 321, 434
DpnII	GATC	4 cut(s)	61, 94, 319, 432
EaeI	YGGCCR	1 cut(s)	76
EciI	GGCGGA	1 cut(s)	20
Eco130I	CCWWGG	3 cut(s)	79, 369, 447
Eco32I	GATATC	1 cut(s)	138
Eco47III	AGCGCT	1 cut(s)	232
Eco57I	CTGAAG	1 cut(s)	27
EcoRV	GATATC	1 cut(s)	138
EcoT14I	CCWWGG	3 cut(s)	79, 369, 447
ErhI	CCWWGG	3 cut(s)	79, 369, 447
FaeI	CATG	4 cut(s)	74, 83, 331, 373
FaiI	YATR	8 cut(s)	72, 81, 154, 156, 329, 337, 371, 417
FatI	CATG	4 cut(s)	70, 79, 327, 369
FbaI	TGATCA	2 cut(s)	94, 319
Fnu4HI	GCNGC	1 cut(s)	288
FokI	GGATG	2 cut(s)	104, 132
Fsp4HI	GCNGC	1 cut(s)	288
FspBI	CTAG	2 cut(s)	234, 303
GlaI	GCGC	2 cut(s)	232, 414
GluI	GCNGC	1 cut(s)	288
HaeII	RGCGCY	1 cut(s)	234
HaeIII	GGCC	2 cut(s)	78, 287
HhaI	GCGC	2 cut(s)	233, 415
Hin1II	CATG	4 cut(s)	74, 83, 331, 373
Hin6I	GCGC	2 cut(s)	231, 413
HinP1I	GCGC	2 cut(s)	231, 413
HindIII	AAGCTT	2 cut(s)	356, 390
HinfI	GANTC	2 cut(s)	172, 443
HphI	GGTGA	4 cut(s)	46, 68, 215, 427
Hpy188I	TCNGA	2 cut(s)	46, 313
Hpy188III	TCNNGA	1 cut(s)	98
HpyAV	CCTTC	2 cut(s)	80, 184
HpyCH4V	TGCA	2 cut(s)	218, 342
HpyF10VI	GCNNNNNNNGC	1 cut(s)	421
HpyF3I	CTNAG	2 cut(s)	409, 420
Hsp92II	CATG	4 cut(s)	74, 83, 331, 373
HspAI	GCGC	2 cut(s)	231, 413
Ksp22I	TGATCA	2 cut(s)	94, 319
Kzo9I	GATC	4 cut(s)	61, 94, 319, 432
LmnI	GCTCC	1 cut(s)	228
LpnPI	CCDG	2 cut(s)	126, 210
MaeI	CTAG	2 cut(s)	234, 303
MaeIII	GTNAC	2 cut(s)	34, 250
MalI	GATC	4 cut(s)	63, 96, 321, 434
MboI	GATC	4 cut(s)	61, 94, 319, 432
MboII	GAAGA	5 cut(s)	33, 128, 142, 269, 452
MlsI	TGGCCA	1 cut(s)	78
MluCI	AATT	3 cut(s)	210, 219, 323
MluNI	TGGCCA	1 cut(s)	78
MlyI	GAGTC	1 cut(s)	437
MmeI	TCCRAC	1 cut(s)	336
MnlI	CCTC	5 cut(s)	97, 106, 319, 390, 421
Mox20I	TGGCCA	1 cut(s)	78
MscI	TGGCCA	1 cut(s)	78
MseI	TTAA	2 cut(s)	360, 405
Msp20I	TGGCCA	1 cut(s)	78
MwoI	GCNNNNNNNGC	1 cut(s)	421
NcoI	CCATGG	2 cut(s)	79, 369
NdeII	GATC	4 cut(s)	61, 94, 319, 432
NlaIII	CATG	4 cut(s)	74, 83, 331, 373
NmuCI	GTSAC	1 cut(s)	34
PfeI	GAWTC	1 cut(s)	172
PflMI	CCANNNNNTGG	1 cut(s)	155
PkrI	GCNGC	1 cut(s)	289
PleI	GAGTC	1 cut(s)	437
PpsI	GAGTC	1 cut(s)	437
RsaI	GTAC	2 cut(s)	19, 238
RsaNI	GTAC	2 cut(s)	18, 237
SaqAI	TTAA	2 cut(s)	360, 405
SatI	GCNGC	1 cut(s)	288
Sau3AI	GATC	4 cut(s)	61, 94, 319, 432
ScaI	AGTACT	1 cut(s)	238
SchI	GAGTC	1 cut(s)	437
SetI	ASST	9 cut(s)	58, 124, 145, 195, 282, 318, 360, 394, 426
SmlI	CTYRAG	3 cut(s)	167, 281, 425
SmoI	CTYRAG	3 cut(s)	167, 281, 425
Sse9I	AATT	3 cut(s)	210, 219, 323
SsiI	CCGC	2 cut(s)	5, 288
SspMI	CTAG	2 cut(s)	234, 303
StyI	CCWWGG	3 cut(s)	79, 369, 447
TasI	AATT	3 cut(s)	210, 219, 323
TatI	WGTACW	1 cut(s)	236
TauI	GCSGC	1 cut(s)	290
TfiI	GAWTC	1 cut(s)	172
Tru1I	TTAA	2 cut(s)	360, 405
Tru9I	TTAA	2 cut(s)	360, 405
TscAI	CASTG	1 cut(s)	268
TseFI	GTSAC	1 cut(s)	34
Tsp45I	GTSAC	1 cut(s)	34
TspDTI	ATGAA	6 cut(s)	59, 63, 222, 316, 384, 391
TspRI	CASTG	1 cut(s)	268
Van91I	CCANNNNNTGG	1 cut(s)	155
XspI	CTAG	2 cut(s)	234, 303
ZrmI	AGTACT	1 cut(s)	238

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.