pycom07g01180

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
925894 .. 926469
576 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g01180.1

Sequence Viewer

Length: 186 bp
ATGAAATTCATGGTGGATGATGCTATCTGGGCTGTTGAAGGTGCCACATTGAAAGCTGAGATGAGTGGAAAGAAGCTAATGCACTCACGGAACAACTTAAGCTCAAGCCTCAACTTCAGACATTTCAAGTGTGGCTTTAGGATGAGGAGGATAATGAAGTGGTTAAGCTGGATACGGTGCATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.27

Weight (kDa)

10.61

Isoelectric Point (pI)

34.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009980)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 41
AcsI RAATTY 1 cut(s) 5
AcuI CTGAAG 1 cut(s) 100
AflII CTTAAG 1 cut(s) 97
AgsI TTSAA 3 cut(s) 38, 52, 127
AluBI AGCT 4 cut(s) 56, 76, 102, 168
AluI AGCT 4 cut(s) 56, 76, 102, 168
ApoI RAATTY 1 cut(s) 5
BanI GGYRCC 1 cut(s) 41
BciVI GTATCC 1 cut(s) 165
BfrI CTTAAG 1 cut(s) 97
BfuI GTATCC 1 cut(s) 165
BmiI GGNNCC 1 cut(s) 43
BmsI GCATC 1 cut(s) 10
BpuEI CTTGAG 1 cut(s) 88
BseGI GGATG 2 cut(s) 22, 147
BseMII CTCAG 1 cut(s) 48
BseRI GAGGAG 1 cut(s) 160
BshNI GGYRCC 1 cut(s) 41
BspCNI CTCAG 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 43
BspT107I GGYRCC 1 cut(s) 41
BspTI CTTAAG 1 cut(s) 97
Bst4CI ACNGT 1 cut(s) 177
BstAFI CTTAAG 1 cut(s) 97
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 2 cut(s) 22, 147
BstMWI GCNNNNNNNGC 1 cut(s) 29
BsuI GTATCC 1 cut(s) 165
BtsCI GGATG 2 cut(s) 22, 147
CviAII CATG 1 cut(s) 10
CviJI RGCY 7 cut(s) 32, 56, 76, 102, 108, 135, 168
CviKI_1 RGCY 7 cut(s) 32, 56, 76, 102, 108, 135, 168
DdeI CTNAG 1 cut(s) 57
Eco57I CTGAAG 1 cut(s) 100
FaeI CATG 1 cut(s) 13
FaiI YATR 3 cut(s) 11, 182, 184
FalI AAGNNNNNCTT 2 cut(s) 119, 151
FatI CATG 1 cut(s) 9
FauNDI CATATG 1 cut(s) 182
FokI GGATG 2 cut(s) 29, 154
Hin1II CATG 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 32
HpyCH4III ACNGT 1 cut(s) 177
HpyCH4V TGCA 2 cut(s) 82, 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 57
Hsp92II CATG 1 cut(s) 13
LpnPI CCDG 2 cut(s) 13, 154
LweI GCATC 1 cut(s) 10
MluCI AATT 1 cut(s) 5
MnlI CCTC 3 cut(s) 119, 138, 141
MseI TTAA 2 cut(s) 98, 164
MspCI CTTAAG 1 cut(s) 97
MwoI GCNNNNNNNGC 1 cut(s) 29
NdeI CATATG 1 cut(s) 182
NlaIII CATG 1 cut(s) 13
NlaIV GGNNCC 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 98, 164
SetI ASST 5 cut(s) 43, 58, 78, 104, 170
SfaNI GCATC 1 cut(s) 10
SgeI CNNG 6 cut(s) 22, 40, 99, 117, 139, 181
SmlI CTYRAG 2 cut(s) 97, 103
SmoI CTYRAG 2 cut(s) 97, 103
Sse9I AATT 1 cut(s) 5
TaaI ACNGT 1 cut(s) 177
TasI AATT 1 cut(s) 5
Tru1I TTAA 2 cut(s) 98, 164
Tru9I TTAA 2 cut(s) 98, 164
TspDTI ATGAA 2 cut(s) 17, 170
TspGWI ACGGA 1 cut(s) 103
Vha464I CTTAAG 1 cut(s) 97
XapI RAATTY 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.