pycom07g13570

F-box kelch-repeat protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
15456843 .. 15457052
210 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g13570.1

Sequence Viewer

Length: 210 bp
ATGATGTGGGAGAAGGAGAGGGAGTGGATCCCTGTCGGGTTGCTGCCATCACGGCTTACTAGACCGCCCTGTCAGCTCGTAGCTATTGGGAAGAAATGTTATGTTGTGGGAAAGGGGATTGGCAGAGTGATGTCTGATGTGAGAAAGGGGCTTGTCAATTCAGTACCTGAACTGAGTTCAGATGACAATGTAATTGGCTGCAAATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.64

Weight (kDa)

9.1

Isoelectric Point (pI)

27.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 69
AciI CCGC 1 cut(s) 65
AclWI GGATC 2 cut(s) 22, 35
AfaI GTAC 1 cut(s) 165
AluBI AGCT 2 cut(s) 76, 83
AluI AGCT 2 cut(s) 76, 83
AlwI GGATC 2 cut(s) 22, 35
AlwNI CAGNNNCTG 1 cut(s) 167
ApeKI GCWGC 2 cut(s) 43, 198
BamHI GGATCC 1 cut(s) 27
BbvI GCAGC 2 cut(s) 30, 185
BccI CCATC 1 cut(s) 55
BceAI ACGGC 1 cut(s) 68
BfaI CTAG 1 cut(s) 60
BglI GCCNNNNNGGC 1 cut(s) 52
BisI GCNGC 2 cut(s) 44, 199
BlsI GCNGC 2 cut(s) 45, 200
BmiI GGNNCC 1 cut(s) 29
BsaXI ACNNNNNCTCC 2 cut(s) 8, 38
BseMII CTCAG 1 cut(s) 164
BseXI GCAGC 2 cut(s) 30, 185
Bsp143I GATC 1 cut(s) 27
BspACI CCGC 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 165
BspLI GGNNCC 1 cut(s) 29
BspPI GGATC 2 cut(s) 22, 35
BssMI GATC 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 173
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BstMWI GCNNNNNNNGC 2 cut(s) 52, 73
BstV1I GCAGC 2 cut(s) 30, 185
BstX2I RGATCY 1 cut(s) 27
BstYI RGATCY 1 cut(s) 27
CaiI CAGNNNCTG 1 cut(s) 167
Csp6I GTAC 1 cut(s) 164
CviJI RGCY 5 cut(s) 55, 76, 83, 151, 198
CviKI_1 RGCY 5 cut(s) 55, 76, 83, 151, 198
CviQI GTAC 1 cut(s) 164
DdeI CTNAG 1 cut(s) 173
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
DrdI GACNNNNNNGTC 1 cut(s) 69
DseDI GACNNNNNNGTC 1 cut(s) 69
FaiI YATR 1 cut(s) 102
Fnu4HI GCNGC 2 cut(s) 44, 199
Fsp4HI GCNGC 2 cut(s) 44, 199
FspBI CTAG 1 cut(s) 60
GluI GCNGC 2 cut(s) 44, 199
Hpy188I TCNGA 2 cut(s) 136, 181
HpyAV CCTTC 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 201
HpyF10VI GCNNNNNNNGC 2 cut(s) 52, 73
HpyF3I CTNAG 1 cut(s) 173
Kzo9I GATC 1 cut(s) 27
LpnPI CCDG 3 cut(s) 45, 82, 180
Lsp1109I GCAGC 2 cut(s) 30, 185
MaeI CTAG 1 cut(s) 60
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 1 cut(s) 103
MflI RGATCY 1 cut(s) 27
MluCI AATT 2 cut(s) 157, 192
MnlI CCTC 1 cut(s) 12
MwoI GCNNNNNNNGC 2 cut(s) 52, 73
NdeII GATC 1 cut(s) 27
NlaIV GGNNCC 1 cut(s) 29
PkrI GCNGC 2 cut(s) 45, 200
PspN4I GGNNCC 1 cut(s) 29
PstNI CAGNNNCTG 1 cut(s) 167
PsuI RGATCY 1 cut(s) 27
RsaI GTAC 1 cut(s) 165
RsaNI GTAC 1 cut(s) 164
SatI GCNGC 2 cut(s) 44, 199
Sau3AI GATC 1 cut(s) 27
SetI ASST 3 cut(s) 78, 85, 169
SgeI CNNG 8 cut(s) 44, 49, 63, 72, 81, 89, 164, 179
Sse9I AATT 2 cut(s) 157, 192
SsiI CCGC 1 cut(s) 65
SspMI CTAG 1 cut(s) 60
TasI AATT 2 cut(s) 157, 192
TseI GCWGC 2 cut(s) 43, 198
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.