Rh3BG328500

UPF0586 protein C9orf41 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0009803
Physical Location & Seq
Reverse (-)
34331975 .. 34332789
815 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG328500.1

Sequence Viewer

Length: 243 bp
ATGGGTCCCCTACTATATCACTTTGCAGATGTGTATGGACAAGGAGATGATATGTCTATTGAACTGAGTTTGGAGGACGTGAAGAGGGTTGCTTTACATTATGGATTTCATATAGAGAAGGAAAAGACCATTGAGACAACCTACACTACAAATCCCAGATCAATGATGCAATTCCCATCTTTGGAGAATGTCACAAGACATACTGGAAACTTATGGAAAATAATGGTTGAGAATGATGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00340 map00340
Pfam Domains
Protein Families
N2227

Protein Analysis

80

Amino Acids

9.25

Weight (kDa)

5.16

Isoelectric Point (pI)

49.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CARME PF07942 1 - 57 1.1e-16 Carnosine N-methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 181
AgsI TTSAA 1 cut(s) 62
AjiI CACGTC 1 cut(s) 79
Alw26I GTCTC 1 cut(s) 128
AspS9I GGNCC 1 cut(s) 5
AvaII GGWCC 1 cut(s) 5
BccI CCATC 2 cut(s) 184, 230
BcoDI GTCTC 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 5
BmgBI CACGTC 1 cut(s) 79
BmgT120I GGNCC 1 cut(s) 5
BmiI GGNNCC 2 cut(s) 6, 7
BmsI GCATC 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 181
Bse1I ACTGG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 56
BseNI ACTGG 1 cut(s) 208
BslI CCNNNNNNNGG 1 cut(s) 181
BsmAI GTCTC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 158
BspCNI CTCAG 1 cut(s) 57
BspLI GGNNCC 2 cut(s) 6, 7
BsrI ACTGG 1 cut(s) 208
BssMI GATC 1 cut(s) 158
Bst6I CTCTTC 1 cut(s) 77
BstDEI CTNAG 1 cut(s) 65
BstKTI GATC 1 cut(s) 161
BstMAI GTCTC 1 cut(s) 128
BstMBI GATC 1 cut(s) 158
BtrI CACGTC 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 5
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 160
DpnII GATC 1 cut(s) 158
Eam1104I CTCTTC 1 cut(s) 77
EarI CTCTTC 1 cut(s) 77
Eco47I GGWCC 1 cut(s) 5
EcoO109I RGGNCCY 1 cut(s) 5
FaiI YATR 8 cut(s) 16, 36, 53, 102, 111, 113, 201, 214
HpyAV CCTTC 1 cut(s) 112
HpyCH4IV ACGT 1 cut(s) 78
HpyCH4V TGCA 2 cut(s) 26, 169
HpyF3I CTNAG 1 cut(s) 65
HpySE526I ACGT 1 cut(s) 78
KflI GGGWCCC 1 cut(s) 5
Kzo9I GATC 1 cut(s) 158
LpnPI CCDG 2 cut(s) 169, 189
LweI GCATC 1 cut(s) 156
MaeII ACGT 1 cut(s) 78
MaeIII GTNAC 1 cut(s) 190
MalI GATC 1 cut(s) 160
MboI GATC 1 cut(s) 158
MboII GAAGA 1 cut(s) 94
MluCI AATT 1 cut(s) 170
MnlI CCTC 2 cut(s) 67, 78
NdeII GATC 1 cut(s) 158
NlaIV GGNNCC 2 cut(s) 6, 7
NmuCI GTSAC 1 cut(s) 190
PpuMI RGGWCCY 1 cut(s) 5
Psp5II RGGWCCY 1 cut(s) 5
PspN4I GGNNCC 2 cut(s) 6, 7
PspPI GGNCC 1 cut(s) 5
PspPPI RGGWCCY 1 cut(s) 5
Sau3AI GATC 1 cut(s) 158
Sau96I GGNCC 1 cut(s) 5
SetI ASST 2 cut(s) 81, 143
SfaNI GCATC 1 cut(s) 156
SgeI CNNG 5 cut(s) 53, 91, 168, 207, 216
SinI GGWCC 1 cut(s) 5
Sse9I AATT 1 cut(s) 170
TaiI ACGT 1 cut(s) 81
TasI AATT 1 cut(s) 170
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 1 cut(s) 98
VpaK11BI GGWCC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.