pycom07g15830
NAC Family

(NAC) domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0007535
Physical Location & Seq
Reverse (-)
18352754 .. 18353389
636 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g15830.2

Sequence Viewer

Length: 435 bp
ATGGATGTGTTGGCCCCTTTCTCCTTCCTGATTCAGAGATATCTGGATTCACCCTTTCCTCCTCCCGAGGCACCTCAGCTGCGTCAACCACCTCGCCTTGGAAATGCTCCTGATATCCGTAGTCATGAATTACTTGATCCTGGTACTGGTGGCTGCATCACCTATAATACTGATAACCAAGCTGCCGCCATGAATCATATGATTACCGTCACTGAAGAAATTCTGGCACACAAACAGCTAGATAGTTCTGTGCTTGGCAGTGGCGATCATGATGATGGTGAACCTGGTAGCGGCATTTCATCTGATTTTACTGATCCAGCTGTAGATGATATGATTCTTGAGGTAAGTATGAATACACGTTTTAAACATTCTGATGTGAACTTGGTAATACAAATTACAAGAAGTGTATATCATATATTAAATGCAATTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM

Protein Analysis

145

Amino Acids

15.77

Weight (kDa)

4.54

Isoelectric Point (pI)

53.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 70
AciI CCGC 2 cut(s) 186, 291
AclWI GGATC 2 cut(s) 131, 308
AcsI RAATTY 1 cut(s) 219
AcuI CTGAAG 1 cut(s) 234
AfaI GTAC 1 cut(s) 145
AfiI CCNNNNNNNGG 3 cut(s) 98, 146, 290
AflIII ACRYGT 1 cut(s) 356
AjnI CCWGG 2 cut(s) 139, 283
AluBI AGCT 4 cut(s) 79, 182, 238, 320
AluI AGCT 4 cut(s) 79, 182, 238, 320
AlwI GGATC 2 cut(s) 131, 308
Ama87I CYCGRG 1 cut(s) 65
AoxI GGCC 1 cut(s) 12
ApeKI GCWGC 3 cut(s) 79, 153, 182
ApoI RAATTY 1 cut(s) 219
Asp700I GAANNNNTTC 1 cut(s) 219
AspS9I GGNCC 1 cut(s) 13
AsuHPI GGTGA 3 cut(s) 42, 151, 290
AvaI CYCGRG 1 cut(s) 65
BanI GGYRCC 1 cut(s) 70
BbvCI CCTCAGC 1 cut(s) 75
BbvI GCAGC 3 cut(s) 66, 140, 169
BccI CCATC 1 cut(s) 269
BciT130I CCWGG 2 cut(s) 141, 285
BfaI CTAG 1 cut(s) 239
BfmI CTRYAG 1 cut(s) 321
BisI GCNGC 5 cut(s) 80, 154, 183, 186, 292
BlsI GCNGC 5 cut(s) 81, 155, 184, 187, 293
Bme1390I CCNGG 2 cut(s) 141, 285
BmeT110I CYCGRG 1 cut(s) 65
BmgT120I GGNCC 1 cut(s) 13
BmiI GGNNCC 2 cut(s) 15, 72
BmrFI CCNGG 2 cut(s) 141, 285
BmsI GCATC 1 cut(s) 165
Bpu10I CCTNAGC 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 359
BsaJI CCNNGG 2 cut(s) 66, 97
Bsc4I CCNNNNNNNGG 3 cut(s) 98, 146, 290
Bse1I ACTGG 1 cut(s) 151
BseBI CCWGG 2 cut(s) 141, 285
BseDI CCNNGG 2 cut(s) 66, 97
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 3 cut(s) 98, 146, 290
BseMII CTCAG 1 cut(s) 89
BseNI ACTGG 1 cut(s) 151
BseRI GAGGAG 1 cut(s) 51
BseXI GCAGC 3 cut(s) 66, 140, 169
BshFI GGCC 1 cut(s) 14
BshNI GGYRCC 1 cut(s) 70
BsiHKCI CYCGRG 1 cut(s) 65
BslI CCNNNNNNNGG 3 cut(s) 98, 146, 290
BsnI GGCC 1 cut(s) 14
BsoBI CYCGRG 1 cut(s) 65
Bsp143I GATC 3 cut(s) 136, 265, 313
BspACI CCGC 2 cut(s) 186, 291
BspANI GGCC 1 cut(s) 14
BspCNI CTCAG 1 cut(s) 88
BspHI TCATGA 2 cut(s) 124, 268
BspLI GGNNCC 2 cut(s) 15, 72
BspPI GGATC 2 cut(s) 131, 308
BspT107I GGYRCC 1 cut(s) 70
BsrI ACTGG 1 cut(s) 151
BssECI CCNNGG 2 cut(s) 66, 97
BssMI GATC 3 cut(s) 136, 265, 313
BssT1I CCWWGG 1 cut(s) 97
Bst2UI CCWGG 2 cut(s) 141, 285
Bst4CI ACNGT 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 75
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 3 cut(s) 139, 268, 316
BstMBI GATC 3 cut(s) 136, 265, 313
BstNI CCWGG 2 cut(s) 141, 285
BstSCI CCNGG 2 cut(s) 139, 283
BstSFI CTRYAG 1 cut(s) 321
BstV1I GCAGC 3 cut(s) 66, 140, 169
BsuRI GGCC 1 cut(s) 14
BtsCI GGATG 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 265
BtsIMutI CAGTG 2 cut(s) 210, 265
CciI TCATGA 2 cut(s) 124, 268
Cfr13I GGNCC 1 cut(s) 13
CseI GACGC 1 cut(s) 71
CsiI ACCWGGT 1 cut(s) 283
Csp6I GTAC 1 cut(s) 144
CviAII CATG 3 cut(s) 125, 190, 269
CviJI RGCY 6 cut(s) 14, 79, 153, 182, 238, 320
CviKI_1 RGCY 6 cut(s) 14, 79, 153, 182, 238, 320
CviQI GTAC 1 cut(s) 144
DdeI CTNAG 1 cut(s) 75
DpnI GATC 3 cut(s) 138, 267, 315
DpnII GATC 3 cut(s) 136, 265, 313
DraI TTTAAA 1 cut(s) 364
Eco130I CCWWGG 1 cut(s) 97
Eco32I GATATC 2 cut(s) 41, 115
Eco57I CTGAAG 1 cut(s) 234
Eco88I CYCGRG 1 cut(s) 65
EcoRII CCWGG 2 cut(s) 139, 283
EcoRV GATATC 2 cut(s) 41, 115
EcoT14I CCWWGG 1 cut(s) 97
ErhI CCWWGG 1 cut(s) 97
FaeI CATG 3 cut(s) 128, 193, 272
FatI CATG 3 cut(s) 124, 189, 268
FauNDI CATATG 1 cut(s) 198
Fnu4HI GCNGC 5 cut(s) 80, 154, 183, 186, 292
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 5 cut(s) 80, 154, 183, 186, 292
FspBI CTAG 1 cut(s) 239
GluI GCNGC 5 cut(s) 80, 154, 183, 186, 292
HaeIII GGCC 1 cut(s) 14
HgaI GACGC 1 cut(s) 71
Hin1II CATG 3 cut(s) 128, 193, 272
HincII GTYRAC 1 cut(s) 86
HindII GTYRAC 1 cut(s) 86
HinfI GANTC 4 cut(s) 31, 47, 193, 334
HphI GGTGA 3 cut(s) 42, 151, 290
Hpy166II GTNNAC 3 cut(s) 86, 281, 379
Hpy188I TCNGA 3 cut(s) 36, 304, 373
Hpy188III TCNNGA 7 cut(s) 28, 44, 65, 110, 125, 269, 338
Hpy8I GTNNAC 3 cut(s) 86, 281, 379
HpyAV CCTTC 1 cut(s) 34
HpyCH4III ACNGT 1 cut(s) 208
HpyCH4IV ACGT 1 cut(s) 358
HpyCH4V TGCA 2 cut(s) 156, 425
HpyF3I CTNAG 1 cut(s) 75
HpySE526I ACGT 1 cut(s) 358
Hsp92II CATG 3 cut(s) 128, 193, 272
Kzo9I GATC 3 cut(s) 136, 265, 313
LmnI GCTCC 1 cut(s) 112
Lsp1109I GCAGC 3 cut(s) 66, 140, 169
LweI GCATC 1 cut(s) 165
MabI ACCWGGT 1 cut(s) 283
MaeI CTAG 1 cut(s) 239
MaeII ACGT 1 cut(s) 358
MaeIII GTNAC 1 cut(s) 208
MalI GATC 3 cut(s) 138, 267, 315
MboI GATC 3 cut(s) 136, 265, 313
MboII GAAGA 1 cut(s) 227
MluCI AATT 4 cut(s) 128, 219, 393, 426
MnlI CCTC 6 cut(s) 61, 69, 72, 84, 102, 334
MroXI GAANNNNTTC 1 cut(s) 219
MseI TTAA 2 cut(s) 363, 419
MslI CAYNNNNRTG 2 cut(s) 273, 372
MspA1I CMGCKG 2 cut(s) 79, 320
MspR9I CCNGG 2 cut(s) 141, 285
MvaI CCWGG 2 cut(s) 141, 285
NdeI CATATG 1 cut(s) 198
NdeII GATC 3 cut(s) 136, 265, 313
NlaIII CATG 3 cut(s) 128, 193, 272
NlaIV GGNNCC 2 cut(s) 15, 72
NmuCI GTSAC 1 cut(s) 208
PagI TCATGA 2 cut(s) 124, 268
PdmI GAANNNNTTC 1 cut(s) 219
PfeI GAWTC 4 cut(s) 31, 47, 193, 334
PkrI GCNGC 5 cut(s) 81, 155, 184, 187, 293
Psp6I CCWGG 2 cut(s) 139, 283
PspGI CCWGG 2 cut(s) 139, 283
PspN4I GGNNCC 2 cut(s) 15, 72
PspPI GGNCC 1 cut(s) 13
PvuII CAGCTG 2 cut(s) 79, 320
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
RseI CAYNNNNRTG 2 cut(s) 273, 372
SaqAI TTAA 2 cut(s) 363, 419
SatI GCNGC 5 cut(s) 80, 154, 183, 186, 292
Sau3AI GATC 3 cut(s) 136, 265, 313
Sau96I GGNCC 1 cut(s) 13
ScrFI CCNGG 2 cut(s) 141, 285
SexAI ACCWGGT 1 cut(s) 283
SfaNI GCATC 1 cut(s) 165
SfcI CTRYAG 1 cut(s) 321
SmiMI CAYNNNNRTG 2 cut(s) 273, 372
SmlI CTYRAG 1 cut(s) 338
SmoI CTYRAG 1 cut(s) 338
Sse9I AATT 4 cut(s) 128, 219, 393, 426
SsiI CCGC 2 cut(s) 186, 291
SspMI CTAG 1 cut(s) 239
StyD4I CCNGG 2 cut(s) 139, 283
StyI CCWWGG 1 cut(s) 97
TaaI ACNGT 1 cut(s) 208
TaiI ACGT 1 cut(s) 361
TasI AATT 4 cut(s) 128, 219, 393, 426
TauI GCSGC 2 cut(s) 188, 294
TfiI GAWTC 4 cut(s) 31, 47, 193, 334
Tru1I TTAA 2 cut(s) 363, 419
Tru9I TTAA 2 cut(s) 363, 419
TscAI CASTG 2 cut(s) 217, 265
TseFI GTSAC 1 cut(s) 208
TseI GCWGC 3 cut(s) 79, 153, 182
Tsp45I GTSAC 1 cut(s) 208
TspDTI ATGAA 4 cut(s) 141, 206, 288, 365
TspGWI ACGGA 1 cut(s) 107
TspRI CASTG 2 cut(s) 217, 265
XapI RAATTY 1 cut(s) 219
XmnI GAANNNNTTC 1 cut(s) 219
XspI CTAG 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.