pycom07g22040

RESISTANCE protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0016961
Physical Location & Seq
Reverse (-)
23485408 .. 23486221
814 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g22040.3

Sequence Viewer

Length: 453 bp
ATGCTCAAGTGGGAAGATGAGTTAGAAAAAATAAGGAAAATCCCGCGAAGGGGAATTCATGATGTGCTTAAATCAAGTTTTGATGGACTAGATGACACAGAGAAAGACATTTTTCTAGATATTGCATGTTTCTTTAAAGGGATGGAGAAAGACCATGCAACCCGAATTCTGGACGGTTGTGATTTCCATCCTTATACAGGAATAAGAGTTCTAATTGATCGATCTCTCATAACTGTCTCAGAGAAGGGGGAACTGGAGATGCATGATTTATTAGAGGAAATGGGTCGGGAAATTGTTCGCCAAGAATCTATCAAAGAGCCTGGGAGACGAAGTAGGTTGTGGAGGTATGAAGATGTTCATGAAGTGCTAACTCAAAATACGGCTACGAAAGCAATTGAAAGCATAATCGTGGATTTCTCGTACTCAGACTGGGTATGCTTAAATCAATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_1 LRR_3 LRR_5 LRR_8 NB-ARC TIR

Protein Analysis

151

Amino Acids

17.6

Weight (kDa)

5.06

Isoelectric Point (pI)

43.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 46
AciI CCGC 1 cut(s) 44
AcsI RAATTY 2 cut(s) 54, 165
AfaI GTAC 1 cut(s) 422
AfiI CCNNNNNNNGG 4 cut(s) 49, 50, 169, 197
AgsI TTSAA 1 cut(s) 398
AjnI CCWGG 1 cut(s) 319
AloI GAACNNNNNNTCC 2 cut(s) 192, 224
Alw26I GTCTC 2 cut(s) 241, 319
ApoI RAATTY 2 cut(s) 54, 165
Asp700I GAANNNNTTC 2 cut(s) 294, 354
BccI CCATC 3 cut(s) 77, 136, 195
BceAI ACGGC 1 cut(s) 396
BciT130I CCWGG 1 cut(s) 321
BcoDI GTCTC 2 cut(s) 241, 319
BfaI CTAG 2 cut(s) 89, 116
Bme1390I CCNGG 1 cut(s) 321
BmrFI CCNGG 1 cut(s) 321
BmrI ACTGGG 1 cut(s) 439
BmsI GCATC 1 cut(s) 249
BmuI ACTGGG 1 cut(s) 439
BpmI CTGGAG 1 cut(s) 275
Bsa29I ATCGAT 1 cut(s) 220
BsaBI GATNNNNATC 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 320
BsaXI ACNNNNNCTCC 2 cut(s) 316, 346
Bsc4I CCNNNNNNNGG 4 cut(s) 49, 50, 169, 197
Bse1I ACTGG 2 cut(s) 258, 434
Bse8I GATNNNNATC 1 cut(s) 186
BseBI CCWGG 1 cut(s) 321
BseCI ATCGAT 1 cut(s) 220
BseDI CCNNGG 1 cut(s) 320
BseGI GGATG 2 cut(s) 147, 187
BseJI GATNNNNATC 1 cut(s) 186
BseLI CCNNNNNNNGG 4 cut(s) 49, 50, 169, 197
BseMII CTCAG 2 cut(s) 252, 438
BseNI ACTGG 2 cut(s) 258, 434
Bsh1236I CGCG 1 cut(s) 46
BshVI ATCGAT 1 cut(s) 220
BslI CCNNNNNNNGG 4 cut(s) 49, 50, 169, 197
BsmAI GTCTC 2 cut(s) 241, 319
BsmBI CGTCTC 1 cut(s) 319
Bsp143I GATC 2 cut(s) 217, 221
BspACI CCGC 1 cut(s) 44
BspCNI CTCAG 2 cut(s) 251, 437
BspDI ATCGAT 1 cut(s) 220
BspFNI CGCG 1 cut(s) 46
BspHI TCATGA 2 cut(s) 58, 358
BsrI ACTGG 2 cut(s) 258, 434
BssECI CCNNGG 1 cut(s) 320
BssMI GATC 2 cut(s) 217, 221
Bst2UI CCWGG 1 cut(s) 321
Bst4CI ACNGT 2 cut(s) 176, 235
BstDEI CTNAG 2 cut(s) 238, 424
BstENI CCTNNNNNAGG 1 cut(s) 195
BstF5I GGATG 2 cut(s) 147, 187
BstFNI CGCG 1 cut(s) 46
BstKTI GATC 2 cut(s) 220, 224
BstMAI GTCTC 2 cut(s) 241, 319
BstMBI GATC 2 cut(s) 217, 221
BstMWI GCNNNNNNNGC 1 cut(s) 389
BstNI CCWGG 1 cut(s) 321
BstNSI RCATGY 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 319
BstUI CGCG 1 cut(s) 46
Bsu15I ATCGAT 1 cut(s) 220
BsuTUI ATCGAT 1 cut(s) 220
BtsCI GGATG 2 cut(s) 147, 187
CciI TCATGA 2 cut(s) 58, 358
ClaI ATCGAT 1 cut(s) 220
Csp6I GTAC 1 cut(s) 421
CviAII CATG 5 cut(s) 59, 126, 155, 263, 359
CviJI RGCY 2 cut(s) 319, 383
CviKI_1 RGCY 2 cut(s) 319, 383
CviQI GTAC 1 cut(s) 421
DdeI CTNAG 2 cut(s) 238, 424
DpnI GATC 2 cut(s) 219, 223
DpnII GATC 2 cut(s) 217, 221
DraI TTTAAA 1 cut(s) 136
EcoNI CCTNNNNNAGG 1 cut(s) 195
EcoRI GAATTC 2 cut(s) 54, 165
EcoRII CCWGG 1 cut(s) 319
EcoT22I ATGCAT 1 cut(s) 264
Esp3I CGTCTC 1 cut(s) 319
FaeI CATG 5 cut(s) 62, 129, 158, 266, 362
FatI CATG 5 cut(s) 58, 125, 154, 262, 358
FauI CCCGC 1 cut(s) 51
FokI GGATG 2 cut(s) 154, 174
FspBI CTAG 2 cut(s) 89, 116
GsuI CTGGAG 1 cut(s) 275
Hin1II CATG 5 cut(s) 62, 129, 158, 266, 362
HinfI GANTC 1 cut(s) 305
Hpy188I TCNGA 2 cut(s) 241, 427
Hpy188III TCNNGA 5 cut(s) 59, 116, 170, 287, 359
HpyAV CCTTC 2 cut(s) 42, 238
HpyCH4III ACNGT 2 cut(s) 176, 235
HpyCH4V TGCA 3 cut(s) 125, 158, 262
HpyF10VI GCNNNNNNNGC 1 cut(s) 389
HpyF3I CTNAG 2 cut(s) 238, 424
Hsp92II CATG 5 cut(s) 62, 129, 158, 266, 362
Kzo9I GATC 2 cut(s) 217, 221
LpnPI CCDG 6 cut(s) 155, 183, 239, 306, 333, 415
LweI GCATC 1 cut(s) 249
MaeI CTAG 2 cut(s) 89, 116
MalI GATC 2 cut(s) 219, 223
MboI GATC 2 cut(s) 217, 221
MboII GAAGA 2 cut(s) 26, 362
MfeI CAATTG 1 cut(s) 393
MluCI AATT 5 cut(s) 54, 165, 213, 291, 393
MnlI CCTC 2 cut(s) 268, 336
Mph1103I ATGCAT 1 cut(s) 264
MroXI GAANNNNTTC 2 cut(s) 294, 354
MseI TTAA 4 cut(s) 69, 135, 440, 451
MslI CAYNNNNRTG 1 cut(s) 407
MspR9I CCNGG 1 cut(s) 321
MunI CAATTG 1 cut(s) 393
MvaI CCWGG 1 cut(s) 321
MvnI CGCG 1 cut(s) 46
MwoI GCNNNNNNNGC 1 cut(s) 389
NdeII GATC 2 cut(s) 217, 221
NlaIII CATG 5 cut(s) 62, 129, 158, 266, 362
NsiI ATGCAT 1 cut(s) 264
NspI RCATGY 1 cut(s) 129
PagI TCATGA 2 cut(s) 58, 358
PdmI GAANNNNTTC 2 cut(s) 294, 354
PfeI GAWTC 1 cut(s) 305
Psp6I CCWGG 1 cut(s) 319
PspGI CCWGG 1 cut(s) 319
RsaI GTAC 1 cut(s) 422
RsaNI GTAC 1 cut(s) 421
RseI CAYNNNNRTG 1 cut(s) 407
SaqAI TTAA 4 cut(s) 69, 135, 440, 451
Sau3AI GATC 2 cut(s) 217, 221
ScrFI CCNGG 1 cut(s) 321
SetI ASST 2 cut(s) 338, 347
SfaNI GCATC 1 cut(s) 249
SmiMI CAYNNNNRTG 1 cut(s) 407
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 5 cut(s) 54, 165, 213, 291, 393
SsiI CCGC 1 cut(s) 44
SspMI CTAG 2 cut(s) 89, 116
StyD4I CCNGG 1 cut(s) 319
TaaI ACNGT 2 cut(s) 176, 235
TaqI TCGA 1 cut(s) 220
TasI AATT 5 cut(s) 54, 165, 213, 291, 393
TfiI GAWTC 1 cut(s) 305
Tru1I TTAA 4 cut(s) 69, 135, 440, 451
Tru9I TTAA 4 cut(s) 69, 135, 440, 451
TspDTI ATGAA 4 cut(s) 47, 347, 363, 375
XagI CCTNNNNNAGG 1 cut(s) 195
XapI RAATTY 2 cut(s) 54, 165
XbaI TCTAGA 1 cut(s) 115
XceI RCATGY 1 cut(s) 129
XmnI GAANNNNTTC 2 cut(s) 294, 354
XspI CTAG 2 cut(s) 89, 116
Zsp2I ATGCAT 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.