pycom10g15280

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0010526
Physical Location & Seq
Reverse (-)
18559688 .. 18560191
504 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g15280.1

Sequence Viewer

Length: 414 bp
ATGACAATAGAGAACAACAAAAATCTTGGCAAGGCTACAACACCAGATGCTAGAGCTTGCTTAGTCCTCCGTCCTCGCGCCGTGTTATCGAGTCCTGAAAATGATGGGATGATTGGAAGCATAAACAAGATAGTCGATCGTAAGAACTCACCGGCTATCAAAGTGAAAAACCCTAATACTGCTACCAGTTCTGCACAAAGGCCCCATCAAGAAGCCAAGAAAGCTCCAAGTCAGGCGAAGAAGAAGGCTACTGCAACTGCAAGGCCTGTGGCTATGAACACGAACAAAGGCTCCAATATTAAAACATTTTTTAACAGTAATAATGGTGATGTGAAAAGTAAGTTTCAGAAACCCTTGGTGGGAAAACAGCATGCAAGTCTTGGAACGCGGGAACCAAGTTTCACTTCAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

14.68

Weight (kDa)

10.62

Isoelectric Point (pI)

43.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 78, 388
AciI CCGC 1 cut(s) 388
AfiI CCNNNNNNNGG 1 cut(s) 359
AgsI TTSAA 1 cut(s) 408
AjuI GAANNNNNNNTTGG 1 cut(s) 388
AloI GAACNNNNNNTCC 2 cut(s) 275, 307
AluBI AGCT 2 cut(s) 56, 224
AluI AGCT 2 cut(s) 56, 224
AoxI GGCC 2 cut(s) 200, 263
AspLEI GCGC 1 cut(s) 80
AspS9I GGNCC 1 cut(s) 201
AsuHPI GGTGA 2 cut(s) 141, 338
BccI CCATC 2 cut(s) 98, 213
BceAI ACGGC 1 cut(s) 65
BfaI CTAG 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 201
BmiI GGNNCC 3 cut(s) 203, 292, 393
BmsI GCATC 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 354
BsaXI ACNNNNNCTCC 2 cut(s) 275, 305
Bsc4I CCNNNNNNNGG 1 cut(s) 359
Bse118I RCCGGY 1 cut(s) 151
Bse1I ACTGG 1 cut(s) 186
BseDI CCNNGG 1 cut(s) 354
BseGI GGATG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 359
BseNI ACTGG 1 cut(s) 186
BsgI GTGCAG 1 cut(s) 177
Bsh1236I CGCG 2 cut(s) 78, 388
Bsh1285I CGRYCG 1 cut(s) 139
BshFI GGCC 2 cut(s) 202, 265
BsiEI CGRYCG 1 cut(s) 139
BsiSI CCGG 1 cut(s) 152
BslI CCNNNNNNNGG 1 cut(s) 359
BsnI GGCC 2 cut(s) 202, 265
Bsp143I GATC 1 cut(s) 136
BspACI CCGC 1 cut(s) 388
BspANI GGCC 2 cut(s) 202, 265
BspFNI CGCG 2 cut(s) 78, 388
BspLI GGNNCC 3 cut(s) 203, 292, 393
BsrFI RCCGGY 1 cut(s) 151
BsrI ACTGG 1 cut(s) 186
BssAI RCCGGY 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 354
BssMI GATC 1 cut(s) 136
BssT1I CCWWGG 1 cut(s) 354
Bst4CI ACNGT 1 cut(s) 317
BstC8I GCNNGC 2 cut(s) 58, 372
BstDEI CTNAG 1 cut(s) 61
BstF5I GGATG 1 cut(s) 114
BstFNI CGCG 2 cut(s) 78, 388
BstHHI GCGC 1 cut(s) 80
BstKTI GATC 1 cut(s) 139
BstMBI GATC 1 cut(s) 136
BstMCI CGRYCG 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 221
BstNSI RCATGY 1 cut(s) 374
BstUI CGCG 2 cut(s) 78, 388
BsuRI GGCC 2 cut(s) 202, 265
BtsCI GGATG 1 cut(s) 114
Cac8I GCNNGC 2 cut(s) 58, 372
CfoI GCGC 1 cut(s) 80
Cfr10I RCCGGY 1 cut(s) 151
Cfr13I GGNCC 1 cut(s) 201
CspCI CAANNNNNGTGG 2 cut(s) 249, 284
CviAII CATG 1 cut(s) 371
DdeI CTNAG 1 cut(s) 61
DpnI GATC 1 cut(s) 138
DpnII GATC 1 cut(s) 136
Eco130I CCWWGG 1 cut(s) 354
Eco147I AGGCCT 1 cut(s) 265
EcoO109I RGGNCCY 1 cut(s) 201
EcoT14I CCWWGG 1 cut(s) 354
ErhI CCWWGG 1 cut(s) 354
FaeI CATG 1 cut(s) 374
FaiI YATR 3 cut(s) 122, 275, 372
FalI AAGNNNNNCTT 1 cut(s) 388
FatI CATG 1 cut(s) 370
FauI CCCGC 1 cut(s) 381
FokI GGATG 1 cut(s) 121
FspBI CTAG 1 cut(s) 51
GlaI GCGC 1 cut(s) 79
HaeIII GGCC 2 cut(s) 202, 265
HapII CCGG 1 cut(s) 152
HhaI GCGC 1 cut(s) 80
Hin1II CATG 1 cut(s) 374
Hin6I GCGC 1 cut(s) 78
HinP1I GCGC 1 cut(s) 78
HinfI GANTC 1 cut(s) 91
HpaII CCGG 1 cut(s) 152
HphI GGTGA 2 cut(s) 141, 338
Hpy188I TCNGA 1 cut(s) 348
Hpy188III TCNNGA 2 cut(s) 95, 209
HpyAV CCTTC 1 cut(s) 238
HpyCH4III ACNGT 1 cut(s) 317
HpyCH4V TGCA 4 cut(s) 194, 254, 260, 374
HpyF10VI GCNNNNNNNGC 1 cut(s) 221
HpyF3I CTNAG 1 cut(s) 61
Hsp92II CATG 1 cut(s) 374
HspAI GCGC 1 cut(s) 78
Kzo9I GATC 1 cut(s) 136
LmnI GCTCC 2 cut(s) 229, 296
LpnPI CCDG 6 cut(s) 57, 108, 165, 199, 218, 279
LweI GCATC 1 cut(s) 37
MaeI CTAG 1 cut(s) 51
MalI GATC 1 cut(s) 138
MboI GATC 1 cut(s) 136
MboII GAAGA 2 cut(s) 250, 253
MlyI GAGTC 1 cut(s) 100
MnlI CCTC 2 cut(s) 77, 84
MseI TTAA 3 cut(s) 300, 312, 412
MspI CCGG 1 cut(s) 152
MvnI CGCG 2 cut(s) 78, 388
MwoI GCNNNNNNNGC 1 cut(s) 221
NdeII GATC 1 cut(s) 136
NlaIII CATG 1 cut(s) 374
NlaIV GGNNCC 3 cut(s) 203, 292, 393
NspI RCATGY 1 cut(s) 374
PaeI GCATGC 1 cut(s) 374
PceI AGGCCT 1 cut(s) 265
Ple19I CGATCG 1 cut(s) 139
PleI GAGTC 1 cut(s) 99
PpsI GAGTC 1 cut(s) 99
PspN4I GGNNCC 3 cut(s) 203, 292, 393
PspPI GGNCC 1 cut(s) 201
PvuI CGATCG 1 cut(s) 139
SaqAI TTAA 3 cut(s) 300, 312, 412
Sau3AI GATC 1 cut(s) 136
Sau96I GGNCC 1 cut(s) 201
SchI GAGTC 1 cut(s) 100
SetI ASST 2 cut(s) 58, 226
SfaNI GCATC 1 cut(s) 37
SphI GCATGC 1 cut(s) 374
SseBI AGGCCT 1 cut(s) 265
SsiI CCGC 1 cut(s) 388
SspI AATATT 1 cut(s) 298
SspMI CTAG 1 cut(s) 51
StuI AGGCCT 1 cut(s) 265
StyI CCWWGG 1 cut(s) 354
TaaI ACNGT 1 cut(s) 317
TaqI TCGA 2 cut(s) 89, 135
Tru1I TTAA 3 cut(s) 300, 312, 412
Tru9I TTAA 3 cut(s) 300, 312, 412
TspDTI ATGAA 1 cut(s) 290
TspGWI ACGGA 1 cut(s) 59
XceI RCATGY 1 cut(s) 374
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.