pycom11g00020

Alpha-ketoglutarate-dependent dioxygenase alkB homolog

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Reverse (-)
27748 .. 28652
905 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 417 bp
ATGGACTTTACTCCCCATTCAAGACTGACTTTGTGCAAAAGTACTTGTGCAAATGCTGTTGAGAATACAAATTCTGATGCGGGGATCATTAATATTAATACAGATAAGTCAATGAATGAACTTCATCCATTTCCTGTCATATTAATGCCTCGCAGTTTGCTGATATTCAAAGATAAAGCATACTCAGATTACTTGCATGCAATAAAAGACTGCGAGGTACAATGTTATGATGGGGCTGTAAACGAAGTACAAGCTCTACAGCGTGGTCAAGTTATAGATGATGATGCTTCACAATTTGATGGAGCTGTTGGTGTAATGAAAACTGGGGATTTTAAGAGAATTCATAGAACTACCCGTAGAATTTCATTGACATGTCGATTAGTTTCAAAAGTTCATAAAAATTTGCTCAGGTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.56

Weight (kDa)

8.3

Isoelectric Point (pI)

29.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 80
AclWI GGATC 1 cut(s) 92
AcsI RAATTY 4 cut(s) 70, 339, 360, 400
AfaI GTAC 3 cut(s) 43, 219, 249
AflIII ACRYGT 1 cut(s) 371
AgsI TTSAA 3 cut(s) 21, 169, 387
AluBI AGCT 2 cut(s) 254, 305
AluI AGCT 2 cut(s) 254, 305
AlwI GGATC 1 cut(s) 92
ApoI RAATTY 4 cut(s) 70, 339, 360, 400
AseI ATTAAT 3 cut(s) 90, 96, 143
BccI CCATC 2 cut(s) 224, 293
BfmI CTRYAG 1 cut(s) 257
BmcAI AGTACT 1 cut(s) 43
BmrI ACTGGG 1 cut(s) 333
BmsI GCATC 2 cut(s) 67, 274
BmuI ACTGGG 1 cut(s) 333
Bpu10I CCTNAGC 1 cut(s) 407
Bse1I ACTGG 1 cut(s) 328
BseGI GGATG 1 cut(s) 124
BseMII CTCAG 1 cut(s) 198
BseNI ACTGG 1 cut(s) 328
Bsp143I GATC 1 cut(s) 84
BspACI CCGC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 197
BspPI GGATC 1 cut(s) 92
BsrI ACTGG 1 cut(s) 328
BssMI GATC 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 198
BstDEI CTNAG 2 cut(s) 184, 407
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 1 cut(s) 87
BstMBI GATC 1 cut(s) 84
BstNSI RCATGY 2 cut(s) 200, 375
BstSFI CTRYAG 1 cut(s) 257
BtsCI GGATG 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 198
Csp6I GTAC 3 cut(s) 42, 218, 248
CviAII CATG 2 cut(s) 197, 372
CviJI RGCY 3 cut(s) 236, 254, 305
CviKI_1 RGCY 3 cut(s) 236, 254, 305
CviQI GTAC 3 cut(s) 42, 218, 248
DdeI CTNAG 2 cut(s) 184, 407
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
EcoRI GAATTC 1 cut(s) 339
FaeI CATG 2 cut(s) 200, 375
FaiI YATR 8 cut(s) 140, 181, 198, 228, 275, 345, 373, 396
FalI AAGNNNNNCTT 2 cut(s) 13, 45
FatI CATG 2 cut(s) 196, 371
FauI CCCGC 1 cut(s) 73
FokI GGATG 1 cut(s) 111
Hin1II CATG 2 cut(s) 200, 375
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 2 cut(s) 76, 187
Hpy188III TCNNGA 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 241
HpyCH4V TGCA 4 cut(s) 36, 50, 196, 200
HpyF3I CTNAG 2 cut(s) 184, 407
Hsp92II CATG 2 cut(s) 200, 375
Kzo9I GATC 1 cut(s) 84
LmnI GCTCC 1 cut(s) 302
LpnPI CCDG 3 cut(s) 147, 309, 394
LweI GCATC 2 cut(s) 67, 274
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MluCI AATT 5 cut(s) 70, 293, 339, 360, 400
MnlI CCTC 2 cut(s) 159, 208
MseI TTAA 4 cut(s) 90, 96, 143, 333
MslI CAYNNNNRTG 2 cut(s) 143, 370
NdeII GATC 1 cut(s) 84
NlaIII CATG 2 cut(s) 200, 375
NspI RCATGY 2 cut(s) 200, 375
PaeI GCATGC 1 cut(s) 200
PciI ACATGT 1 cut(s) 371
PscI ACATGT 1 cut(s) 371
PshBI ATTAAT 3 cut(s) 90, 96, 143
RsaI GTAC 3 cut(s) 43, 219, 249
RsaNI GTAC 3 cut(s) 42, 218, 248
RseI CAYNNNNRTG 2 cut(s) 143, 370
SaqAI TTAA 4 cut(s) 90, 96, 143, 333
Sau3AI GATC 1 cut(s) 84
ScaI AGTACT 1 cut(s) 43
SetI ASST 4 cut(s) 219, 256, 307, 413
SfaNI GCATC 2 cut(s) 67, 274
SfcI CTRYAG 1 cut(s) 257
SmiMI CAYNNNNRTG 2 cut(s) 143, 370
SphI GCATGC 1 cut(s) 200
Sse9I AATT 5 cut(s) 70, 293, 339, 360, 400
SsiI CCGC 1 cut(s) 80
SspI AATATT 1 cut(s) 94
TaqI TCGA 1 cut(s) 376
TasI AATT 5 cut(s) 70, 293, 339, 360, 400
TatI WGTACW 2 cut(s) 41, 247
Tru1I TTAA 4 cut(s) 90, 96, 143, 333
Tru9I TTAA 4 cut(s) 90, 96, 143, 333
TspDTI ATGAA 7 cut(s) 113, 128, 132, 332, 332, 354, 383
VspI ATTAAT 3 cut(s) 90, 96, 143
XapI RAATTY 4 cut(s) 70, 339, 360, 400
XceI RCATGY 2 cut(s) 200, 375
ZrmI AGTACT 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.