pycom11g00080

Transcription factor Pur-alpha

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Reverse (-)
83285 .. 83664
380 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g00080.2

Sequence Viewer

Length: 246 bp
ATGGGGATATCTAAAGTGATCAGAGCTGATCAAAAGAGATTCTTCTTTGATCTTGGGAATAATAACAGGGGTCACTTCCTAAGAATATCCGAGGTTGCAGGTTCTGATCGGTCCTCCATAATTCTTCCGCTGTCAGGGCTCAAGCAGTTCTATGAAATAGTAGGTCACTTTGTGGAGATAACCAAAGACCGAATTGAAGGAATGACAGGTGCAAATGTTCGGACAGTGGATTCCCCCCAGAGATGA
Functional Annotation

Protein Analysis

82

Amino Acids

9.14

Weight (kDa)

9.81

Isoelectric Point (pI)

41.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011498)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 89
AciI CCGC 1 cut(s) 128
AdeI CACNNNGTG 1 cut(s) 172
AfiI CCNNNNNNNGG 1 cut(s) 134
AgsI TTSAA 1 cut(s) 197
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
AlwNI CAGNNNCTG 1 cut(s) 104
AspS9I GGNCC 1 cut(s) 111
AvaII GGWCC 1 cut(s) 111
BanII GRGCYC 1 cut(s) 141
BclI TGATCA 2 cut(s) 18, 28
BfuAI ACCTGC 1 cut(s) 89
Bme18I GGWCC 1 cut(s) 111
BmgT120I GGNCC 1 cut(s) 111
BpuEI CTTGAG 1 cut(s) 125
BsaJI CCNNGG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 134
BslI CCNNNNNNNGG 1 cut(s) 134
Bsp1286I GDGCHC 1 cut(s) 141
Bsp143I GATC 4 cut(s) 18, 28, 49, 106
BspACI CCGC 1 cut(s) 128
BspMI ACCTGC 1 cut(s) 89
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 4 cut(s) 18, 28, 49, 106
Bst4CI ACNGT 1 cut(s) 226
BstDEI CTNAG 1 cut(s) 80
BstKTI GATC 4 cut(s) 21, 31, 52, 109
BstMBI GATC 4 cut(s) 18, 28, 49, 106
BstMWI GCNNNNNNNGC 1 cut(s) 136
BtsIMutI CAGTG 1 cut(s) 231
BveI ACCTGC 1 cut(s) 89
CaiI CAGNNNCTG 1 cut(s) 104
Cfr13I GGNCC 1 cut(s) 111
CviJI RGCY 2 cut(s) 26, 139
CviKI_1 RGCY 2 cut(s) 26, 139
DdeI CTNAG 1 cut(s) 80
DpnI GATC 4 cut(s) 20, 30, 51, 108
DpnII GATC 4 cut(s) 18, 28, 49, 106
DraIII CACNNNGTG 1 cut(s) 172
Eco24I GRGCYC 1 cut(s) 141
Eco32I GATATC 1 cut(s) 9
Eco47I GGWCC 1 cut(s) 111
EcoRV GATATC 1 cut(s) 9
EcoT38I GRGCYC 1 cut(s) 141
FaiI YATR 2 cut(s) 119, 153
FalI AAGNNNNNCTT 2 cut(s) 26, 58
FbaI TGATCA 2 cut(s) 18, 28
FriOI GRGCYC 1 cut(s) 141
HinfI GANTC 2 cut(s) 39, 230
Hpy188I TCNGA 4 cut(s) 23, 91, 106, 222
HpyAV CCTTC 1 cut(s) 191
HpyCH4III ACNGT 1 cut(s) 226
HpyCH4V TGCA 2 cut(s) 98, 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 136
HpyF3I CTNAG 1 cut(s) 80
Ksp22I TGATCA 2 cut(s) 18, 28
Kzo9I GATC 4 cut(s) 18, 28, 49, 106
LpnPI CCDG 4 cut(s) 52, 84, 120, 192
MaeIII GTNAC 2 cut(s) 71, 164
MalI GATC 4 cut(s) 20, 30, 51, 108
MboI GATC 4 cut(s) 18, 28, 49, 106
MboII GAAGA 2 cut(s) 34, 116
MhlI GDGCHC 1 cut(s) 141
MluCI AATT 2 cut(s) 120, 192
MnlI CCTC 2 cut(s) 85, 124
MspA1I CMGCKG 1 cut(s) 130
MwoI GCNNNNNNNGC 1 cut(s) 136
NdeII GATC 4 cut(s) 18, 28, 49, 106
NmuCI GTSAC 2 cut(s) 71, 164
PfeI GAWTC 2 cut(s) 39, 230
PspPI GGNCC 1 cut(s) 111
PstNI CAGNNNCTG 1 cut(s) 104
Sau3AI GATC 4 cut(s) 18, 28, 49, 106
Sau96I GGNCC 1 cut(s) 111
SduI GDGCHC 1 cut(s) 141
SetI ASST 5 cut(s) 28, 96, 103, 166, 211
SgeI CNNG 7 cut(s) 65, 79, 103, 111, 147, 154, 219
SinI GGWCC 1 cut(s) 111
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
Sse9I AATT 2 cut(s) 120, 192
SsiI CCGC 1 cut(s) 128
TaaI ACNGT 1 cut(s) 226
TaqII GACCGA 2 cut(s) 99, 204
TasI AATT 2 cut(s) 120, 192
TfiI GAWTC 2 cut(s) 39, 230
TscAI CASTG 1 cut(s) 231
TseFI GTSAC 2 cut(s) 71, 164
Tsp45I GTSAC 2 cut(s) 71, 164
TspDTI ATGAA 1 cut(s) 168
TspRI CASTG 1 cut(s) 231
VpaK11BI GGWCC 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.