pycom12g10550

Glutamate receptor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
12557463 .. 12557735
273 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g10550.1

Sequence Viewer

Length: 273 bp
ATGAGGGAGCAAACTGCTCAAATCCAAATGGGTCCAGATGAGCTTGGGGATTTTCTTGATGGTGACAATGTCGAGCAAGAAGTAGATAAGAGTCCTTGGCAAACTAGTGTGTATCAACAACCAGGAAAAGTTAGACCTGGTCAAGTGGAAGTATCATTTCCACAATCACAACTAAGGAGGTCAACGAGAATACGTAAGACAAATCCAAAATACACCAGCATAGCAATAGATGAAGAAGCAGTTGAACGTAAGATGCGTGAAAAAGTATCATAG

Protein Analysis

91

Amino Acids

10.38

Weight (kDa)

5.46

Isoelectric Point (pI)

45.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 245
AhlI ACTAGT 1 cut(s) 104
AjnI CCWGG 2 cut(s) 121, 136
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AspS9I GGNCC 1 cut(s) 32
AsuHPI GGTGA 1 cut(s) 74
AvaII GGWCC 1 cut(s) 32
BccI CCATC 1 cut(s) 53
BciT130I CCWGG 2 cut(s) 123, 138
BcuI ACTAGT 1 cut(s) 104
BfaI CTAG 1 cut(s) 105
Bme1390I CCNGG 2 cut(s) 123, 138
Bme18I GGWCC 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 33
BmrFI CCNGG 2 cut(s) 123, 138
BmsI GCATC 1 cut(s) 243
BsaAI YACGTR 1 cut(s) 194
BsaJI CCNNGG 1 cut(s) 95
BseBI CCWGG 2 cut(s) 123, 138
BseDI CCNNGG 1 cut(s) 95
BspLI GGNNCC 1 cut(s) 33
BssECI CCNNGG 1 cut(s) 95
BssT1I CCWWGG 1 cut(s) 95
Bst2UI CCWGG 2 cut(s) 123, 138
BstBAI YACGTR 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 173
BstNI CCWGG 2 cut(s) 123, 138
BstSCI CCNGG 2 cut(s) 121, 136
BstSNI TACGTA 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 32
CsiI ACCWGGT 1 cut(s) 136
CviJI RGCY 1 cut(s) 43
CviKI_1 RGCY 1 cut(s) 43
DdeI CTNAG 1 cut(s) 173
Eco105I TACGTA 1 cut(s) 194
Eco130I CCWWGG 1 cut(s) 95
Eco47I GGWCC 1 cut(s) 32
EcoRII CCWGG 2 cut(s) 121, 136
EcoT14I CCWWGG 1 cut(s) 95
ErhI CCWWGG 1 cut(s) 95
FaiI YATR 2 cut(s) 221, 271
FspBI CTAG 1 cut(s) 105
HincII GTYRAC 1 cut(s) 183
HindII GTYRAC 1 cut(s) 183
HinfI GANTC 1 cut(s) 91
HphI GGTGA 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 183
Hpy188III TCNNGA 2 cut(s) 35, 56
Hpy8I GTNNAC 1 cut(s) 183
HpyCH4IV ACGT 2 cut(s) 193, 247
HpyF3I CTNAG 1 cut(s) 173
HpySE526I ACGT 2 cut(s) 193, 247
LmnI GCTCC 1 cut(s) 7
LpnPI CCDG 6 cut(s) 48, 108, 123, 135, 150, 229
LweI GCATC 1 cut(s) 243
MabI ACCWGGT 1 cut(s) 136
MaeI CTAG 1 cut(s) 105
MaeII ACGT 2 cut(s) 193, 247
MaeIII GTNAC 1 cut(s) 62
MboII GAAGA 1 cut(s) 245
MlyI GAGTC 1 cut(s) 100
MnlI CCTC 1 cut(s) 171
MspR9I CCNGG 2 cut(s) 123, 138
MvaI CCWGG 2 cut(s) 123, 138
NlaIV GGNNCC 1 cut(s) 33
NmuCI GTSAC 1 cut(s) 62
PcsI WCGNNNNNNNCGW 1 cut(s) 253
PflFI GACNNNGTC 2 cut(s) 68, 138
PleI GAGTC 1 cut(s) 99
PpsI GAGTC 1 cut(s) 99
Ppu21I YACGTR 1 cut(s) 194
Psp6I CCWGG 2 cut(s) 121, 136
PspGI CCWGG 2 cut(s) 121, 136
PspN4I GGNNCC 1 cut(s) 33
PspPI GGNCC 1 cut(s) 32
PsyI GACNNNGTC 2 cut(s) 68, 138
Sau96I GGNCC 1 cut(s) 32
SchI GAGTC 1 cut(s) 100
ScrFI CCNGG 2 cut(s) 123, 138
SetI ASST 5 cut(s) 45, 139, 182, 196, 250
SexAI ACCWGGT 1 cut(s) 136
SfaNI GCATC 1 cut(s) 243
SinI GGWCC 1 cut(s) 32
SnaBI TACGTA 1 cut(s) 194
SpeI ACTAGT 1 cut(s) 104
SspMI CTAG 1 cut(s) 105
StyD4I CCNGG 2 cut(s) 121, 136
StyI CCWWGG 1 cut(s) 95
TaiI ACGT 2 cut(s) 196, 250
TaqI TCGA 1 cut(s) 72
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 1 cut(s) 246
Tth111I GACNNNGTC 2 cut(s) 68, 138
VpaK11BI GGWCC 1 cut(s) 32
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.