pycom13g09790

ATP-dependent DNA helicase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
6544248 .. 6545202
955 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g09790.1

Sequence Viewer

Length: 411 bp
ATGTCGTTAGAGTTACCGGCTGTGGCAAATAGCATTGAAGTTACAGCTATCGTCTTATCAAATCATCTACAAAAATGCTTTGAAAGAATCATATTTCTGAGAGTTGAAAATGGAAAGACGCGAGGTTGTTGTGATGCCCAACGCACACAATGTTTGCAAAAGAAGATTATGGAATATTTCAATGTAGATGACAATTCTGAACTCCCTAATACGATGGGTAAACCCAGGAGTTTCTGCAGAGCCATTCACAGGCCAAATTCACCACAGAGCTGTTGCAAGAATATAATTCATGGGATTGCAAGTCCATCCTATCCTTGTGGTTTGACCCCATTTGAAGTGTTCCAAGTCACTCGCCTGGCAATGCACTTTTATATGGTATCAAGTTCTTCACTACGAACAAATTTGAGCTGA

Protein Analysis

137

Amino Acids

15.33

Weight (kDa)

8.87

Isoelectric Point (pI)

59.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 121
AcsI RAATTY 2 cut(s) 256, 400
AfiI CCNNNNNNNGG 1 cut(s) 249
AgsI TTSAA 5 cut(s) 38, 83, 107, 181, 335
AjnI CCWGG 2 cut(s) 224, 354
AluBI AGCT 3 cut(s) 47, 270, 408
AluI AGCT 3 cut(s) 47, 270, 408
AoxI GGCC 1 cut(s) 251
ApoI RAATTY 2 cut(s) 256, 400
AsuHPI GGTGA 1 cut(s) 252
BccI CCATC 2 cut(s) 208, 313
BciT130I CCWGG 2 cut(s) 226, 356
BfmI CTRYAG 1 cut(s) 235
Bme1390I CCNGG 2 cut(s) 226, 356
BmrFI CCNGG 2 cut(s) 226, 356
BmsI GCATC 1 cut(s) 124
BsaJI CCNNGG 1 cut(s) 224
Bsc4I CCNNNNNNNGG 1 cut(s) 249
Bse118I RCCGGY 1 cut(s) 16
Bse3DI GCAATG 1 cut(s) 366
BseBI CCWGG 2 cut(s) 226, 356
BseDI CCNNGG 1 cut(s) 224
BseGI GGATG 1 cut(s) 305
BseLI CCNNNNNNNGG 1 cut(s) 249
BseMI GCAATG 1 cut(s) 366
BseMII CTCAG 1 cut(s) 89
Bsh1236I CGCG 1 cut(s) 121
BshFI GGCC 1 cut(s) 253
BsiSI CCGG 1 cut(s) 17
BslI CCNNNNNNNGG 1 cut(s) 249
BsnI GGCC 1 cut(s) 253
BspANI GGCC 1 cut(s) 253
BspCNI CTCAG 1 cut(s) 90
BspFNI CGCG 1 cut(s) 121
BspMAI CTGCAG 1 cut(s) 239
BsrDI GCAATG 1 cut(s) 366
BsrFI RCCGGY 1 cut(s) 16
BssAI RCCGGY 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 224
Bst2UI CCWGG 2 cut(s) 226, 356
BstDEI CTNAG 1 cut(s) 98
BstF5I GGATG 1 cut(s) 305
BstFNI CGCG 1 cut(s) 121
BstNI CCWGG 2 cut(s) 226, 356
BstSCI CCNGG 2 cut(s) 224, 354
BstSFI CTRYAG 1 cut(s) 235
BstUI CGCG 1 cut(s) 121
BsuRI GGCC 1 cut(s) 253
BtsCI GGATG 1 cut(s) 305
Cfr10I RCCGGY 1 cut(s) 16
CseI GACGC 1 cut(s) 127
CviAII CATG 1 cut(s) 290
CviJI RGCY 6 cut(s) 20, 47, 242, 253, 270, 408
CviKI_1 RGCY 6 cut(s) 20, 47, 242, 253, 270, 408
DdeI CTNAG 1 cut(s) 98
EcoRII CCWGG 2 cut(s) 224, 354
FaeI CATG 1 cut(s) 293
FaiI YATR 6 cut(s) 92, 170, 284, 291, 372, 374
FatI CATG 1 cut(s) 289
FokI GGATG 1 cut(s) 292
HaeIII GGCC 1 cut(s) 253
HapII CCGG 1 cut(s) 17
HgaI GACGC 1 cut(s) 127
Hin1II CATG 1 cut(s) 293
HinfI GANTC 1 cut(s) 87
HpaII CCGG 1 cut(s) 17
HphI GGTGA 1 cut(s) 252
Hpy166II GTNNAC 1 cut(s) 221
Hpy188I TCNGA 2 cut(s) 99, 199
Hpy8I GTNNAC 1 cut(s) 221
HpyCH4V TGCA 5 cut(s) 157, 237, 276, 299, 364
HpyF3I CTNAG 1 cut(s) 98
Hsp92II CATG 1 cut(s) 293
LpnPI CCDG 6 cut(s) 30, 211, 235, 238, 341, 368
LweI GCATC 1 cut(s) 124
MaeIII GTNAC 3 cut(s) 12, 40, 346
MboII GAAGA 2 cut(s) 175, 378
MluCI AATT 4 cut(s) 193, 256, 285, 400
MnlI CCTC 1 cut(s) 116
MspI CCGG 1 cut(s) 17
MspR9I CCNGG 2 cut(s) 226, 356
MvaI CCWGG 2 cut(s) 226, 356
MvnI CGCG 1 cut(s) 121
NlaIII CATG 1 cut(s) 293
NmuCI GTSAC 1 cut(s) 346
PfeI GAWTC 1 cut(s) 87
Psp6I CCWGG 2 cut(s) 224, 354
PspGI CCWGG 2 cut(s) 224, 354
PstI CTGCAG 1 cut(s) 239
ScrFI CCNGG 2 cut(s) 226, 356
SetI ASST 4 cut(s) 49, 127, 272, 410
SfaNI GCATC 1 cut(s) 124
SfcI CTRYAG 1 cut(s) 235
Sse9I AATT 4 cut(s) 193, 256, 285, 400
SspI AATATT 1 cut(s) 176
StyD4I CCNGG 2 cut(s) 224, 354
TasI AATT 4 cut(s) 193, 256, 285, 400
TfiI GAWTC 1 cut(s) 87
TseFI GTSAC 1 cut(s) 346
Tsp45I GTSAC 1 cut(s) 346
TspDTI ATGAA 1 cut(s) 278
XapI RAATTY 2 cut(s) 256, 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.