pycom13g28640

Protein of unknown function (DUF788)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Reverse (-)
24580574 .. 24582509
1936 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 402 bp
ATGGCAAATCAAGGTGCAAAGAAGCGCAAGGAAGAGAATGCCCGACACATGGCAAATCTCCGTCGCCTGATCATAGCCTGTAATGTTTTTTATGTACTACTAAGGATGCTCATCTTCTATTCTAGTTTCACCTGGAAAAATTGGGTTGCTTTGCTTCTCACTTCACTCGCTTATTACTTTCCCTATCAACAACTCGCTCAAATGGCAAATCCTTCTTGTGGCGATGATGGGGAACTTCTGGATGGTGGCTTTGATATGACAACTGGTGGAGTATGTGGCTATTTGCATGATGTAATCTACATCAAAGGCTTTGTGCAAGTCATGTCCATAATCTCCGGAAAATTTTGGTACACATCTGCTGATACCAGGTTTTGGAGCATACAAATCATTTGGTTTCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

15.4

Weight (kDa)

8.81

Isoelectric Point (pI)

38.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMEM208_SND2 PF05620 1 - 118 3.8e-40 SRP-independent targeting protein 2/TMEM208
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 372
AccIII TCCGGA 1 cut(s) 335
AcsI RAATTY 1 cut(s) 341
AfaI GTAC 2 cut(s) 96, 350
AfiI CCNNNNNNNGG 3 cut(s) 49, 218, 372
AjnI CCWGG 2 cut(s) 131, 365
Aor13HI TCCGGA 1 cut(s) 335
ApoI RAATTY 1 cut(s) 341
AspLEI GCGC 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 121
BccI CCATC 2 cut(s) 221, 236
BciT130I CCWGG 2 cut(s) 133, 367
BclI TGATCA 1 cut(s) 69
BfaI CTAG 1 cut(s) 123
Bme1390I CCNGG 2 cut(s) 133, 367
BmrFI CCNGG 2 cut(s) 133, 367
BmsI GCATC 1 cut(s) 96
BsaBI GATNNNNATC 1 cut(s) 110
BsaWI WCCGGW 1 cut(s) 335
Bsc4I CCNNNNNNNGG 3 cut(s) 49, 218, 372
Bse1I ACTGG 1 cut(s) 268
Bse8I GATNNNNATC 1 cut(s) 110
BseAI TCCGGA 1 cut(s) 335
BseBI CCWGG 2 cut(s) 133, 367
BseGI GGATG 2 cut(s) 111, 247
BseJI GATNNNNATC 1 cut(s) 110
BseLI CCNNNNNNNGG 3 cut(s) 49, 218, 372
BseNI ACTGG 1 cut(s) 268
BsiSI CCGG 1 cut(s) 336
BslI CCNNNNNNNGG 3 cut(s) 49, 218, 372
BsmI GAATGC 1 cut(s) 43
Bsp13I TCCGGA 1 cut(s) 335
Bsp143I GATC 1 cut(s) 69
BspEI TCCGGA 1 cut(s) 335
BsrI ACTGG 1 cut(s) 268
BssMI GATC 1 cut(s) 69
Bst2UI CCWGG 2 cut(s) 133, 367
Bst6I CTCTTC 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 101
BstF5I GGATG 2 cut(s) 111, 247
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 1 cut(s) 72
BstMBI GATC 1 cut(s) 69
BstMWI GCNNNNNNNGC 1 cut(s) 203
BstNI CCWGG 2 cut(s) 133, 367
BstSCI CCNGG 2 cut(s) 131, 365
BtgZI GCGATG 1 cut(s) 237
BtsCI GGATG 2 cut(s) 111, 247
CfoI GCGC 1 cut(s) 27
CsiI ACCWGGT 1 cut(s) 365
Csp6I GTAC 2 cut(s) 95, 349
CviAII CATG 3 cut(s) 49, 287, 322
CviJI RGCY 4 cut(s) 77, 249, 279, 309
CviKI_1 RGCY 4 cut(s) 77, 249, 279, 309
CviQI GTAC 2 cut(s) 95, 349
DdeI CTNAG 1 cut(s) 101
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
EcoRII CCWGG 2 cut(s) 131, 365
FaeI CATG 3 cut(s) 52, 290, 325
FaiI YATR 9 cut(s) 50, 74, 93, 257, 274, 288, 323, 329, 380
FatI CATG 3 cut(s) 48, 286, 321
FbaI TGATCA 1 cut(s) 69
FokI GGATG 2 cut(s) 118, 254
FspBI CTAG 1 cut(s) 123
GlaI GCGC 1 cut(s) 26
HapII CCGG 1 cut(s) 336
HhaI GCGC 1 cut(s) 27
Hin1II CATG 3 cut(s) 52, 290, 325
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HpaII CCGG 1 cut(s) 336
HphI GGTGA 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 351
Hpy188III TCNNGA 2 cut(s) 239, 336
Hpy8I GTNNAC 1 cut(s) 351
Hpy99I CGWCG 1 cut(s) 66
HpyAV CCTTC 1 cut(s) 222
HpyCH4V TGCA 3 cut(s) 17, 286, 316
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
HpyF3I CTNAG 1 cut(s) 101
Hsp92II CATG 3 cut(s) 52, 290, 325
HspAI GCGC 1 cut(s) 25
Kpn2I TCCGGA 1 cut(s) 335
Ksp22I TGATCA 1 cut(s) 69
Kzo9I GATC 1 cut(s) 69
LmnI GCTCC 1 cut(s) 375
LpnPI CCDG 9 cut(s) 80, 91, 118, 145, 224, 249, 349, 352, 379
LweI GCATC 1 cut(s) 96
MabI ACCWGGT 1 cut(s) 365
MaeI CTAG 1 cut(s) 123
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MboII GAAGA 2 cut(s) 44, 106
MluCI AATT 2 cut(s) 139, 341
MroI TCCGGA 1 cut(s) 335
MspI CCGG 1 cut(s) 336
MspR9I CCNGG 2 cut(s) 133, 367
Mva1269I GAATGC 1 cut(s) 43
MvaI CCWGG 2 cut(s) 133, 367
MwoI GCNNNNNNNGC 1 cut(s) 203
NdeII GATC 1 cut(s) 69
NlaIII CATG 3 cut(s) 52, 290, 325
PctI GAATGC 1 cut(s) 43
PflMI CCANNNNNTGG 1 cut(s) 372
Psp6I CCWGG 2 cut(s) 131, 365
PspGI CCWGG 2 cut(s) 131, 365
RsaI GTAC 2 cut(s) 96, 350
RsaNI GTAC 2 cut(s) 95, 349
Sau3AI GATC 1 cut(s) 69
ScrFI CCNGG 2 cut(s) 133, 367
SetI ASST 3 cut(s) 16, 134, 371
SexAI ACCWGGT 1 cut(s) 365
SfaNI GCATC 1 cut(s) 96
Sse9I AATT 2 cut(s) 139, 341
SspMI CTAG 1 cut(s) 123
StyD4I CCNGG 2 cut(s) 131, 365
TasI AATT 2 cut(s) 139, 341
TatI WGTACW 1 cut(s) 94
TspDTI ATGAA 1 cut(s) 386
TspGWI ACGGA 1 cut(s) 50
Van91I CCANNNNNTGG 1 cut(s) 372
XapI RAATTY 1 cut(s) 341
XspI CTAG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.