pycom16g04840

D-aminoacyl-tRNA deacylase-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
3104752 .. 3105055
304 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGTCTGGATTTAACGGGGTGTGGGTAGGCCATCTACTTTCGGGTTATTCCTTGCCGATGGAAGATCCAAATCAGTCCAAAGCAGGAACAAATGCAAAAGATACGAAAGACATTGGTGGAACTTGGAAACACGCAATCAAAGCAGCATTTAAGGCTACCCAATCGGCTTTCCCTGGTGGGGAAGTTATAGCTCATCTTGATCAAAAGTAA

Protein Analysis

70

Amino Acids

7.31

Weight (kDa)

8.09

Isoelectric Point (pI)

17.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AfiI CCNNNNNNNGG 1 cut(s) 178
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 1 cut(s) 191
AluI AGCT 1 cut(s) 191
AlwI GGATC 1 cut(s) 59
AoxI GGCC 1 cut(s) 28
ApeKI GCWGC 1 cut(s) 143
BbvI GCAGC 1 cut(s) 155
BccI CCATC 2 cut(s) 39, 52
BciT130I CCWGG 1 cut(s) 174
BclI TGATCA 1 cut(s) 199
BisI GCNGC 1 cut(s) 144
BlsI GCNGC 1 cut(s) 145
Bme1390I CCNGG 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 174
BsaBI GATNNNNATC 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 172
Bsc4I CCNNNNNNNGG 1 cut(s) 178
Bse8I GATNNNNATC 1 cut(s) 69
BseBI CCWGG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 172
BseJI GATNNNNATC 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 178
BseXI GCAGC 1 cut(s) 155
BshFI GGCC 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 178
BsnI GGCC 1 cut(s) 30
Bsp143I GATC 2 cut(s) 64, 199
BspANI GGCC 1 cut(s) 30
BspPI GGATC 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 2 cut(s) 64, 199
Bst2UI CCWGG 1 cut(s) 174
BstKTI GATC 2 cut(s) 67, 202
BstMBI GATC 2 cut(s) 64, 199
BstMWI GCNNNNNNNGC 2 cut(s) 140, 152
BstNI CCWGG 1 cut(s) 174
BstSCI CCNGG 1 cut(s) 172
BstV1I GCAGC 1 cut(s) 155
BstX2I RGATCY 1 cut(s) 64
BstYI RGATCY 1 cut(s) 64
BsuRI GGCC 1 cut(s) 30
CviJI RGCY 4 cut(s) 30, 155, 167, 191
CviKI_1 RGCY 4 cut(s) 30, 155, 167, 191
DpnI GATC 2 cut(s) 66, 201
DpnII GATC 2 cut(s) 64, 199
EcoRII CCWGG 1 cut(s) 172
FaiI YATR 1 cut(s) 188
FbaI TGATCA 1 cut(s) 199
Fnu4HI GCNGC 1 cut(s) 144
Fsp4HI GCNGC 1 cut(s) 144
GluI GCNGC 1 cut(s) 144
HaeIII GGCC 1 cut(s) 30
Hpy188III TCNNGA 2 cut(s) 6, 197
HpyCH4V TGCA 1 cut(s) 95
HpyF10VI GCNNNNNNNGC 2 cut(s) 140, 152
Ksp22I TGATCA 1 cut(s) 199
Kzo9I GATC 2 cut(s) 64, 199
LpnPI CCDG 3 cut(s) 69, 159, 186
Lsp1109I GCAGC 1 cut(s) 155
MalI GATC 2 cut(s) 66, 201
MboI GATC 2 cut(s) 64, 199
MboII GAAGA 1 cut(s) 74
MflI RGATCY 1 cut(s) 64
MseI TTAA 2 cut(s) 12, 150
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
MwoI GCNNNNNNNGC 2 cut(s) 140, 152
NdeII GATC 2 cut(s) 64, 199
PkrI GCNGC 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PsuI RGATCY 1 cut(s) 64
SaqAI TTAA 2 cut(s) 12, 150
SatI GCNGC 1 cut(s) 144
Sau3AI GATC 2 cut(s) 64, 199
ScrFI CCNGG 1 cut(s) 174
SetI ASST 1 cut(s) 193
SgeI CNNG 9 cut(s) 18, 28, 54, 64, 96, 135, 143, 185, 186
StyD4I CCNGG 1 cut(s) 172
Tru1I TTAA 2 cut(s) 12, 150
Tru9I TTAA 2 cut(s) 12, 150
TseI GCWGC 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.