Rmu_co8359351.1_g000001

Transposase family tnp2

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8359351.1
Physical Location & Seq
Forward (+)
92 .. 544
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8359351.1_g000001.1.cds

Sequence Viewer

Length: 453 bp
atgggtgtgaggcaagactattggcctagagaggtggatggtaaaccagtttatgacccagcaccttttgcattgtcaaatgatgatatcaaagctgtatgtgaatggttactgaaattgcaggttccagatggatattgtgcaaatttgtcaggttgggtgagtgctggagggtggagtatttctggcatgaaaagtcatgattgtcatgttttcttagagagattactcccgcttgtggtgagagagatgttgcctaaacaatcatgtggggctataattgagctttcttactttttcaaagaattgtgtgctaaagtacttaagatctctgatttagagctactggacaatcaaattatcacaactctatgcaagttggaaagaatattccctcctgcttttttcgacatcatggttcacctatctattcacttagcttgggaagcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

150

Amino Acids

17.03

Weight (kDa)

5.29

Isoelectric Point (pI)

32.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 112
AciI CCGC 1 cut(s) 233
AcsI RAATTY 1 cut(s) 145
AfaI GTAC 1 cut(s) 321
AfiI CCNNNNNNNGG 1 cut(s) 238
AflII CTTAAG 1 cut(s) 323
AgsI TTSAA 1 cut(s) 301
AluBI AGCT 4 cut(s) 95, 286, 343, 440
AluI AGCT 4 cut(s) 95, 286, 343, 440
AoxI GGCC 1 cut(s) 23
ApoI RAATTY 1 cut(s) 145
AsuHPI GGTGA 3 cut(s) 172, 253, 413
BccI CCATC 2 cut(s) 32, 125
BfaI CTAG 1 cut(s) 27
BfrI CTTAAG 1 cut(s) 323
BfuAI ACCTGC 1 cut(s) 112
BglII AGATCT 1 cut(s) 327
BmcAI AGTACT 1 cut(s) 321
BmiI GGNNCC 1 cut(s) 126
BpmI CTGGAG 1 cut(s) 189
Bsc4I CCNNNNNNNGG 1 cut(s) 238
Bse1I ACTGG 2 cut(s) 47, 351
BseGI GGATG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 238
BseNI ACTGG 2 cut(s) 47, 351
BseYI CCCAGC 1 cut(s) 58
BshFI GGCC 1 cut(s) 25
BslI CCNNNNNNNGG 1 cut(s) 238
BsnI GGCC 1 cut(s) 25
Bsp143I GATC 1 cut(s) 327
BspACI CCGC 1 cut(s) 233
BspANI GGCC 1 cut(s) 25
BspHI TCATGA 1 cut(s) 199
BspLI GGNNCC 1 cut(s) 126
BspMI ACCTGC 1 cut(s) 112
BspTI CTTAAG 1 cut(s) 323
BsrI ACTGG 2 cut(s) 47, 351
BssMI GATC 1 cut(s) 327
BstAFI CTTAAG 1 cut(s) 323
BstAPI GCANNNNNTGC 1 cut(s) 68
BstDEI CTNAG 2 cut(s) 217, 436
BstF5I GGATG 1 cut(s) 43
BstKTI GATC 1 cut(s) 330
BstMBI GATC 1 cut(s) 327
BstMWI GCNNNNNNNGC 2 cut(s) 68, 446
BstX2I RGATCY 1 cut(s) 327
BstYI RGATCY 1 cut(s) 327
BsuRI GGCC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 43
BveI ACCTGC 1 cut(s) 112
CciI TCATGA 1 cut(s) 199
Csp6I GTAC 1 cut(s) 320
CviAII CATG 5 cut(s) 190, 200, 209, 267, 415
CviJI RGCY 6 cut(s) 25, 95, 275, 286, 343, 440
CviKI_1 RGCY 6 cut(s) 25, 95, 275, 286, 343, 440
CviQI GTAC 1 cut(s) 320
DdeI CTNAG 2 cut(s) 217, 436
DpnI GATC 1 cut(s) 329
DpnII GATC 1 cut(s) 327
Eco32I GATATC 1 cut(s) 88
EcoRV GATATC 1 cut(s) 88
FaeI CATG 5 cut(s) 193, 203, 212, 270, 418
FatI CATG 5 cut(s) 189, 199, 208, 266, 414
FauI CCCGC 1 cut(s) 240
FokI GGATG 1 cut(s) 50
FspBI CTAG 1 cut(s) 27
GsaI CCCAGC 1 cut(s) 62
GsuI CTGGAG 1 cut(s) 189
HaeIII GGCC 1 cut(s) 25
Hin1II CATG 5 cut(s) 193, 203, 212, 270, 418
HphI GGTGA 3 cut(s) 172, 253, 413
Hpy166II GTNNAC 2 cut(s) 44, 421
Hpy188I TCNGA 1 cut(s) 334
Hpy188III TCNNGA 2 cut(s) 128, 200
Hpy8I GTNNAC 2 cut(s) 44, 421
HpyCH4V TGCA 4 cut(s) 71, 121, 143, 375
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 446
HpyF3I CTNAG 2 cut(s) 217, 436
Hsp92II CATG 5 cut(s) 193, 203, 212, 270, 418
Kzo9I GATC 1 cut(s) 327
LpnPI CCDG 9 cut(s) 60, 72, 107, 138, 141, 153, 171, 332, 411
MaeI CTAG 1 cut(s) 27
MaeIII GTNAC 1 cut(s) 108
MalI GATC 1 cut(s) 329
MboI GATC 1 cut(s) 327
MflI RGATCY 1 cut(s) 327
MluCI AATT 5 cut(s) 116, 145, 279, 305, 357
MmeI TCCRAC 1 cut(s) 360
MnlI CCTC 4 cut(s) 3, 25, 164, 405
MseI TTAA 1 cut(s) 324
MspCI CTTAAG 1 cut(s) 323
MwoI GCNNNNNNNGC 2 cut(s) 68, 446
NdeII GATC 1 cut(s) 327
NlaIII CATG 5 cut(s) 193, 203, 212, 270, 418
NlaIV GGNNCC 1 cut(s) 126
PagI TCATGA 1 cut(s) 199
PspFI CCCAGC 1 cut(s) 58
PspN4I GGNNCC 1 cut(s) 126
PsuI RGATCY 1 cut(s) 327
RsaI GTAC 1 cut(s) 321
RsaNI GTAC 1 cut(s) 320
SaqAI TTAA 1 cut(s) 324
Sau3AI GATC 1 cut(s) 327
ScaI AGTACT 1 cut(s) 321
SetI ASST 9 cut(s) 36, 67, 97, 126, 157, 288, 345, 426, 442
SmlI CTYRAG 1 cut(s) 323
SmoI CTYRAG 1 cut(s) 323
Sse9I AATT 5 cut(s) 116, 145, 279, 305, 357
SsiI CCGC 1 cut(s) 233
SspI AATATT 1 cut(s) 390
SspMI CTAG 1 cut(s) 27
TaqI TCGA 1 cut(s) 408
TasI AATT 5 cut(s) 116, 145, 279, 305, 357
TatI WGTACW 1 cut(s) 319
Tru1I TTAA 1 cut(s) 324
Tru9I TTAA 1 cut(s) 324
TspDTI ATGAA 1 cut(s) 206
Vha464I CTTAAG 1 cut(s) 323
XapI RAATTY 1 cut(s) 145
XspI CTAG 1 cut(s) 27
ZrmI AGTACT 1 cut(s) 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.