Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000144.1

Orthogroup ID

OG0014837

Physical Location & Seq

Genomic Coordinates Reverse (-)

43120 .. 44481

Gene Structure 1362 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000144.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

atgtacaggaaagatgatgtctgggtgggccgtctaatttcgggttattcgttaccaatggaagatccgagccagtccaagacagaaacaaatacaaaagatatcggtggaacttggaaacaatcaatcaaagtagcatttgaggctacgcaatcggctttccctgaggctcaaatggatcctgatgcaggagcttcatattatctttctcgtctacctagctacttaggagaatacttagctcttacaggggacaaacttaatggtgcaggagaatacttagcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002161 GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006139 GO:0006399 GO:0006450 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0034660 GO:0043170 GO:0044237 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0051499 GO:0052689 GO:0065007 GO:0065008 GO:0071704 GO:0090304 GO:0106074 GO:0140098 GO:0140101 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

tRNA_deacylase

Protein Analysis

95

Amino Acids

10.46

Weight (kDa)

4.62

Isoelectric Point (pI)

30.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014837)

Species	Orthologous Gene IDs
pyrus_communis	pycom11g14990 pycom16g04840
rosa_laevigata	RLG00000015505 RLG00000015509
rosa_multiflora	Rmu_co8359351.1_g000001 Rmu_sc0002500.1_g000004 Rmu_sc0004178.1_g000006 Rmu_sc0020641.1_g000001 Rmu_ssc0000144.1_g000008
rosa_roxburghii	Rroxscaffold_2G00116500
rosa_samantha	Rh1AG103200 Rh2AG206200 Rh4DG231600 Rh6BG154700 Rh6DG139900
rosa_wichuraiana	Rw1G014030 Rw2G017010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	214
AclWI	GGATC	3 cut(s)	59, 173, 186
AfaI	GTAC	1 cut(s)	5
AfiI	CCNNNNNNNGG	1 cut(s)	188
AluBI	AGCT	4 cut(s)	194, 222, 242, 284
AluI	AGCT	4 cut(s)	194, 222, 242, 284
AlwI	GGATC	3 cut(s)	59, 173, 186
AoxI	GGCC	1 cut(s)	28
AspS9I	GGNCC	1 cut(s)	28
AxyI	CCTNAGG	1 cut(s)	165
BamHI	GGATCC	1 cut(s)	178
BceAI	ACGGC	1 cut(s)	15
BfaI	CTAG	1 cut(s)	219
BmgT120I	GGNCC	1 cut(s)	28
BmiI	GGNNCC	1 cut(s)	180
BmsI	GCATC	1 cut(s)	175
Bsc4I	CCNNNNNNNGG	1 cut(s)	188
Bse1I	ACTGG	1 cut(s)	73
Bse21I	CCTNAGG	1 cut(s)	165
BseLI	CCNNNNNNNGG	1 cut(s)	188
BseMII	CTCAG	1 cut(s)	156
BseNI	ACTGG	1 cut(s)	73
BsgI	GTGCAG	1 cut(s)	288
BshFI	GGCC	1 cut(s)	30
BslFI	GGGAC	1 cut(s)	266
BslI	CCNNNNNNNGG	1 cut(s)	188
BsmFI	GGGAC	1 cut(s)	266
BsnI	GGCC	1 cut(s)	30
Bsp1407I	TGTACA	1 cut(s)	3
Bsp143I	GATC	2 cut(s)	64, 178
BspANI	GGCC	1 cut(s)	30
BspCNI	CTCAG	1 cut(s)	157
BspLI	GGNNCC	1 cut(s)	180
BspPI	GGATC	3 cut(s)	59, 173, 186
BsrGI	TGTACA	1 cut(s)	3
BsrI	ACTGG	1 cut(s)	73
BssMI	GATC	2 cut(s)	64, 178
BstAUI	TGTACA	1 cut(s)	3
BstDEI	CTNAG	4 cut(s)	165, 226, 238, 280
BstENI	CCTNNNNNAGG	1 cut(s)	186
BstKTI	GATC	2 cut(s)	67, 181
BstMBI	GATC	2 cut(s)	64, 178
BstMWI	GCNNNNNNNGC	1 cut(s)	143
BstX2I	RGATCY	2 cut(s)	64, 178
BstYI	RGATCY	2 cut(s)	64, 178
Bsu36I	CCTNAGG	1 cut(s)	165
BsuRI	GGCC	1 cut(s)	30
Cfr13I	GGNCC	1 cut(s)	28
Csp6I	GTAC	1 cut(s)	4
CviJI	RGCY	9 cut(s)	30, 72, 146, 158, 170, 194, 222, 242, 284
CviKI_1	RGCY	9 cut(s)	30, 72, 146, 158, 170, 194, 222, 242, 284
CviQI	GTAC	1 cut(s)	4
DdeI	CTNAG	4 cut(s)	165, 226, 238, 280
DpnI	GATC	2 cut(s)	66, 180
DpnII	GATC	2 cut(s)	64, 178
Eco32I	GATATC	1 cut(s)	103
Eco81I	CCTNAGG	1 cut(s)	165
EcoNI	CCTNNNNNAGG	1 cut(s)	186
EcoRV	GATATC	1 cut(s)	103
FaiI	YATR	1 cut(s)	199
FaqI	GGGAC	1 cut(s)	266
FblI	GTMKAC	1 cut(s)	214
FspBI	CTAG	1 cut(s)	219
HaeIII	GGCC	1 cut(s)	30
Hpy166II	GTNNAC	1 cut(s)	215
Hpy188I	TCNGA	1 cut(s)	69
Hpy188III	TCNNGA	1 cut(s)	182
Hpy8I	GTNNAC	1 cut(s)	215
HpyCH4V	TGCA	2 cut(s)	188, 269
HpyF10VI	GCNNNNNNNGC	1 cut(s)	143
HpyF3I	CTNAG	4 cut(s)	165, 226, 238, 280
Kzo9I	GATC	2 cut(s)	64, 178
LmnI	GCTCC	1 cut(s)	191
LpnPI	CCDG	7 cut(s)	7, 86, 174, 177, 195, 234, 255
LweI	GCATC	1 cut(s)	175
MaeI	CTAG	1 cut(s)	219
MaeIII	GTNAC	1 cut(s)	51
MalI	GATC	2 cut(s)	66, 180
MboI	GATC	2 cut(s)	64, 178
MboII	GAAGA	1 cut(s)	74
MflI	RGATCY	2 cut(s)	64, 178
MluCI	AATT	1 cut(s)	36
MnlI	CCTC	2 cut(s)	136, 160
MseI	TTAA	1 cut(s)	261
MwoI	GCNNNNNNNGC	1 cut(s)	143
NdeII	GATC	2 cut(s)	64, 178
NlaIV	GGNNCC	1 cut(s)	180
PcsI	WCGNNNNNNNCGW	1 cut(s)	47
PspN4I	GGNNCC	1 cut(s)	180
PspPI	GGNCC	1 cut(s)	28
PsuI	RGATCY	2 cut(s)	64, 178
RsaI	GTAC	1 cut(s)	5
RsaNI	GTAC	1 cut(s)	4
SaqAI	TTAA	1 cut(s)	261
Sau3AI	GATC	2 cut(s)	64, 178
Sau96I	GGNCC	1 cut(s)	28
SetI	ASST	5 cut(s)	196, 220, 224, 244, 286
SfaNI	GCATC	1 cut(s)	175
Sse9I	AATT	1 cut(s)	36
SspMI	CTAG	1 cut(s)	219
TasI	AATT	1 cut(s)	36
TatI	WGTACW	1 cut(s)	3
Tru1I	TTAA	1 cut(s)	261
Tru9I	TTAA	1 cut(s)	261
TspDTI	ATGAA	1 cut(s)	186
XagI	CCTNNNNNAGG	1 cut(s)	186
XmiI	GTMKAC	1 cut(s)	214
XspI	CTAG	1 cut(s)	219

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.