pycom17g06530
MADS Family

MADS-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0006987
Physical Location & Seq
Forward (+)
4704505 .. 4704693
189 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGGGGAGAGGAAGAGTGGAGCTGAAGAGGATAGAGAACAAGATAAACAGGCAAGTCACATTTGCAAAGAGAAGAAATGGGCTTCTAAAGAAAGCTTATGAGCTCTCCGTTCTCTGCGATGCTGAGGTTGCTCTCATCATCTTCTCCAACCGTGGCAAGCTCTATGAGTTTTGCAGCAGCTCTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SRF-TF

Protein Analysis

63

Amino Acids

7.18

Weight (kDa)

10.22

Isoelectric Point (pI)

42.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRF-TF PF00319 10 - 57 6.9e-28 SRF-type transcription factor (DNA-binding and dimerisation domain)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 44
AluBI AGCT 5 cut(s) 22, 95, 103, 160, 180
AluI AGCT 5 cut(s) 22, 95, 103, 160, 180
Alw21I GWGCWC 1 cut(s) 105
ApeKI GCWGC 2 cut(s) 174, 177
BanII GRGCYC 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 105
BbvCI CCTCAGC 1 cut(s) 123
BfaI CTAG 1 cut(s) 183
BisI GCNGC 2 cut(s) 175, 178
BlsI GCNGC 2 cut(s) 176, 179
BmsI GCATC 1 cut(s) 109
Bpu10I CCTNAGC 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 151
BseDI CCNNGG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 114
BsiHKAI GWGCWC 1 cut(s) 105
Bsp1286I GDGCHC 1 cut(s) 105
BspCNI CTCAG 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 151
Bst4CI ACNGT 1 cut(s) 152
Bst6I CTCTTC 2 cut(s) 7, 20
BstC8I GCNNGC 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 123
BstDSI CCRYGG 1 cut(s) 151
BstMWI GCNNNNNNNGC 1 cut(s) 128
BtgI CCRYGG 1 cut(s) 151
BtgZI GCGATG 1 cut(s) 132
Cac8I GCNNGC 1 cut(s) 158
CviJI RGCY 6 cut(s) 22, 82, 95, 103, 160, 180
CviKI_1 RGCY 6 cut(s) 22, 82, 95, 103, 160, 180
DdeI CTNAG 1 cut(s) 123
Eam1104I CTCTTC 2 cut(s) 7, 20
EarI CTCTTC 2 cut(s) 7, 20
Ecl136II GAGCTC 1 cut(s) 103
Eco24I GRGCYC 1 cut(s) 105
Eco53kI GAGCTC 1 cut(s) 103
Eco57I CTGAAG 1 cut(s) 44
EcoICRI GAGCTC 1 cut(s) 103
EcoT38I GRGCYC 1 cut(s) 105
FaiI YATR 2 cut(s) 99, 165
Fnu4HI GCNGC 2 cut(s) 175, 178
FriOI GRGCYC 1 cut(s) 105
Fsp4HI GCNGC 2 cut(s) 175, 178
FspBI CTAG 1 cut(s) 183
GluI GCNGC 2 cut(s) 175, 178
HindIII AAGCTT 1 cut(s) 93
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4V TGCA 2 cut(s) 65, 174
HpyF10VI GCNNNNNNNGC 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 123
LmnI GCTCC 1 cut(s) 19
LpnPI CCDG 1 cut(s) 34
LweI GCATC 1 cut(s) 109
MaeI CTAG 1 cut(s) 183
MaeIII GTNAC 1 cut(s) 55
MboII GAAGA 4 cut(s) 24, 37, 84, 133
MhlI GDGCHC 1 cut(s) 105
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 2 cut(s) 21, 118
MwoI GCNNNNNNNGC 1 cut(s) 128
NmuCI GTSAC 1 cut(s) 55
PkrI GCNGC 2 cut(s) 176, 179
Psp124BI GAGCTC 1 cut(s) 105
SacI GAGCTC 1 cut(s) 105
SatI GCNGC 2 cut(s) 175, 178
SduI GDGCHC 1 cut(s) 105
SetI ASST 7 cut(s) 24, 97, 105, 129, 162, 182, 188
SfaNI GCATC 1 cut(s) 109
SgeI CNNG 5 cut(s) 52, 61, 65, 164, 169
SspMI CTAG 1 cut(s) 183
SstI GAGCTC 1 cut(s) 105
TaaI ACNGT 1 cut(s) 152
TseFI GTSAC 1 cut(s) 55
TseI GCWGC 2 cut(s) 174, 177
Tsp45I GTSAC 1 cut(s) 55
TspGWI ACGGA 1 cut(s) 97
XspI CTAG 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.