pycom17g23090

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
21501376 .. 21501660
285 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 285 bp
ATGGTTCTTGAGAGCATTTTGTCTTCTCCTATTCGGAAGTCAGCATCATTTAGAAAGCAATTCTCACAAAATGAGTTGGGTAGCTGGTCGACAGTCTTTCAGAGACACCGCTTCCTCTTAACAGCCCTAGCACTCCTGGCTTTCCTCTGCACCATTTATCTTTACTTTGCAGTCACATTAGGAGGCAGTCCATCATGTTCGGGTTTGAGTGGAACTCAAAAAGCGTTGTGTAGCATGGAGCATGCAAAGACTTCAGTTGCCCATGGAAAATTGAAAATTCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.28

Weight (kDa)

9.86

Isoelectric Point (pI)

34.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 89
AciI CCGC 1 cut(s) 109
AcsI RAATTY 1 cut(s) 276
AcuI CTGAAG 1 cut(s) 237
AgsI TTSAA 1 cut(s) 274
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 1 cut(s) 84
AluI AGCT 1 cut(s) 84
Alw26I GTCTC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 276
BbsI GAAGAC 1 cut(s) 15
BccI CCATC 1 cut(s) 199
BciT130I CCWGG 1 cut(s) 137
BcoDI GTCTC 1 cut(s) 97
BfaI CTAG 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 137
BmrFI CCNGG 1 cut(s) 137
BmsI GCATC 1 cut(s) 53
BpiI GAAGAC 1 cut(s) 15
BplI GAGNNNNNCTC 2 cut(s) 199, 231
BpuEI CTTGAG 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 262
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 262
BsgI GTGCAG 1 cut(s) 133
BsmAI GTCTC 1 cut(s) 97
Bsp19I CCATGG 1 cut(s) 262
BspACI CCGC 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 262
BssT1I CCWWGG 1 cut(s) 262
Bst2UI CCWGG 1 cut(s) 137
Bst4CI ACNGT 1 cut(s) 94
BstC8I GCNNGC 1 cut(s) 243
BstDSI CCRYGG 1 cut(s) 262
BstMAI GTCTC 1 cut(s) 97
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstNI CCWGG 1 cut(s) 137
BstNSI RCATGY 1 cut(s) 245
BstSCI CCNGG 1 cut(s) 135
BstV2I GAAGAC 1 cut(s) 15
BtgI CCRYGG 1 cut(s) 262
Cac8I GCNNGC 1 cut(s) 243
CviAII CATG 4 cut(s) 195, 235, 242, 263
CviJI RGCY 3 cut(s) 84, 125, 140
CviKI_1 RGCY 3 cut(s) 84, 125, 140
Eco130I CCWWGG 1 cut(s) 262
Eco57I CTGAAG 1 cut(s) 237
EcoRII CCWGG 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 262
ErhI CCWWGG 1 cut(s) 262
FaeI CATG 4 cut(s) 198, 238, 245, 266
FaiI YATR 4 cut(s) 196, 236, 243, 264
FatI CATG 4 cut(s) 194, 234, 241, 262
FblI GTMKAC 1 cut(s) 89
FspBI CTAG 1 cut(s) 128
Hin1II CATG 4 cut(s) 198, 238, 245, 266
HincII GTYRAC 1 cut(s) 90
HindII GTYRAC 1 cut(s) 90
Hpy166II GTNNAC 1 cut(s) 90
Hpy188I TCNGA 2 cut(s) 36, 102
Hpy188III TCNNGA 1 cut(s) 8
Hpy8I GTNNAC 1 cut(s) 90
HpyCH4III ACNGT 1 cut(s) 94
HpyCH4V TGCA 3 cut(s) 150, 170, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
Hsp92II CATG 4 cut(s) 198, 238, 245, 266
LmnI GCTCC 1 cut(s) 238
LpnPI CCDG 3 cut(s) 70, 122, 149
LweI GCATC 1 cut(s) 53
MaeI CTAG 1 cut(s) 128
MaeIII GTNAC 1 cut(s) 172
MboII GAAGA 1 cut(s) 15
MluCI AATT 3 cut(s) 59, 269, 276
MnlI CCTC 3 cut(s) 125, 155, 176
MseI TTAA 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 137
NcoI CCATGG 1 cut(s) 262
NlaIII CATG 4 cut(s) 198, 238, 245, 266
NmuCI GTSAC 1 cut(s) 172
NspI RCATGY 1 cut(s) 245
PaeI GCATGC 1 cut(s) 245
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
SalI GTCGAC 1 cut(s) 88
SaqAI TTAA 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 137
SetI ASST 1 cut(s) 86
SfaNI GCATC 1 cut(s) 53
SmlI CTYRAG 1 cut(s) 8
SmoI CTYRAG 1 cut(s) 8
SphI GCATGC 1 cut(s) 245
Sse9I AATT 3 cut(s) 59, 269, 276
SsiI CCGC 1 cut(s) 109
SspMI CTAG 1 cut(s) 128
StyD4I CCNGG 1 cut(s) 135
StyI CCWWGG 1 cut(s) 262
TaaI ACNGT 1 cut(s) 94
TaqI TCGA 1 cut(s) 89
TasI AATT 3 cut(s) 59, 269, 276
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TseFI GTSAC 1 cut(s) 172
Tsp45I GTSAC 1 cut(s) 172
XapI RAATTY 1 cut(s) 276
XceI RCATGY 1 cut(s) 245
XmiI GTMKAC 1 cut(s) 89
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.