Rmu_sc0000584.1_g000009

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000584.1
Physical Location & Seq
Forward (+)
38587 .. 43803
5217 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000584.1_g000009.1.cds

Sequence Viewer

Length: 549 bp
atggggacggggacgaggaatccccagtatcttattacggggattggggagggtacggggatggagaatgaagtcgggtatggggatgacaataagcctagcagattaggattgtggatgacgatggctagggtttctactttgccaccacaacccttttcttcttgtccagcgtcgtcatttgatatcggcgtcaaattccattctctctttcaatcccgatcttgcctcatccgttgtctgaggaaggtcagtacatacaccatggttattgacagcattttgtcttctcctgtccgaaggacagcatcattcagaaaacaattttcacagaatgagttaggtagctggtcaacgctccttcaaaggcaccgattcctattaacagccctcgttctcctgacattcctctgcactgtgtatctttactttgctgtcactttaggagccaatgggtcatgttctgggatgagtggaactgaaaaggcattgtgtcatttggagcatgctaagacttcagtttcccatggaaaattgaaatttttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

182

Amino Acids

20.09

Weight (kDa)

9.54

Isoelectric Point (pI)

53.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 369
AcsI RAATTY 2 cut(s) 197, 539
AcuI CTGAAG 1 cut(s) 501
AcyI GRCGYC 1 cut(s) 192
AfaI GTAC 2 cut(s) 55, 256
AgsI TTSAA 3 cut(s) 215, 365, 538
AluBI AGCT 1 cut(s) 348
AluI AGCT 1 cut(s) 348
ApoI RAATTY 2 cut(s) 197, 539
BanI GGYRCC 1 cut(s) 369
BbsI GAAGAC 1 cut(s) 279
BccI CCATC 2 cut(s) 55, 118
BfaI CTAG 2 cut(s) 99, 129
BmiI GGNNCC 2 cut(s) 371, 448
BmrI ACTGGG 1 cut(s) 19
BmsI GCATC 1 cut(s) 317
BmuI ACTGGG 1 cut(s) 19
BpiI GAAGAC 1 cut(s) 279
BsaHI GRCGYC 1 cut(s) 192
BsaJI CCNNGG 2 cut(s) 264, 526
Bse1I ACTGG 1 cut(s) 25
BseDI CCNNGG 2 cut(s) 264, 526
BseGI GGATG 5 cut(s) 66, 91, 123, 231, 474
BseMII CTCAG 1 cut(s) 233
BseNI ACTGG 1 cut(s) 25
BsgI GTGCAG 1 cut(s) 397
BshNI GGYRCC 1 cut(s) 369
BslFI GGGAC 2 cut(s) 19, 25
BsmFI GGGAC 2 cut(s) 19, 25
Bsp143I GATC 1 cut(s) 221
Bsp19I CCATGG 2 cut(s) 264, 526
BspCNI CTCAG 1 cut(s) 234
BspLI GGNNCC 2 cut(s) 371, 448
BspT107I GGYRCC 1 cut(s) 369
BsrI ACTGG 1 cut(s) 25
BssECI CCNNGG 2 cut(s) 264, 526
BssMI GATC 1 cut(s) 221
BssNI GRCGYC 1 cut(s) 192
BssT1I CCWWGG 2 cut(s) 264, 526
Bst4CI ACNGT 1 cut(s) 418
BstACI GRCGYC 1 cut(s) 192
BstC8I GCNNGC 1 cut(s) 507
BstDEI CTNAG 2 cut(s) 242, 510
BstDSI CCRYGG 2 cut(s) 264, 526
BstF5I GGATG 5 cut(s) 66, 91, 123, 231, 474
BstKTI GATC 1 cut(s) 224
BstMBI GATC 1 cut(s) 221
BstNSI RCATGY 1 cut(s) 509
BstV2I GAAGAC 1 cut(s) 279
BtgI CCRYGG 2 cut(s) 264, 526
BtsCI GGATG 5 cut(s) 66, 91, 123, 231, 474
BtsIMutI CAGTG 1 cut(s) 414
Cac8I GCNNGC 1 cut(s) 507
CseI GACGC 2 cut(s) 162, 181
Csp6I GTAC 2 cut(s) 54, 255
CviAII CATG 4 cut(s) 265, 459, 506, 527
CviJI RGCY 5 cut(s) 97, 128, 348, 389, 449
CviKI_1 RGCY 5 cut(s) 97, 128, 348, 389, 449
CviQI GTAC 2 cut(s) 54, 255
DdeI CTNAG 2 cut(s) 242, 510
DpnI GATC 1 cut(s) 223
DpnII GATC 1 cut(s) 221
Eco130I CCWWGG 2 cut(s) 264, 526
Eco32I GATATC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 501
EcoRV GATATC 1 cut(s) 187
EcoT14I CCWWGG 2 cut(s) 264, 526
ErhI CCWWGG 2 cut(s) 264, 526
FaeI CATG 4 cut(s) 268, 462, 509, 530
FaiI YATR 6 cut(s) 81, 259, 266, 460, 507, 528
FaqI GGGAC 2 cut(s) 19, 25
FatI CATG 4 cut(s) 264, 458, 505, 526
FokI GGATG 5 cut(s) 73, 98, 130, 218, 481
FspBI CTAG 2 cut(s) 99, 129
HgaI GACGC 2 cut(s) 162, 181
Hin1I GRCGYC 1 cut(s) 192
Hin1II CATG 4 cut(s) 268, 462, 509, 530
HincII GTYRAC 1 cut(s) 354
HindII GTYRAC 1 cut(s) 354
HinfI GANTC 2 cut(s) 19, 375
Hpy166II GTNNAC 1 cut(s) 354
Hpy188I TCNGA 3 cut(s) 243, 299, 317
Hpy188III TCNNGA 2 cut(s) 219, 400
Hpy8I GTNNAC 1 cut(s) 354
Hpy99I CGWCG 1 cut(s) 178
HpyAV CCTTC 3 cut(s) 241, 294, 371
HpyCH4III ACNGT 1 cut(s) 418
HpyCH4V TGCA 1 cut(s) 414
HpyF3I CTNAG 2 cut(s) 242, 510
Hsp92I GRCGYC 1 cut(s) 192
Hsp92II CATG 4 cut(s) 268, 462, 509, 530
Kzo9I GATC 1 cut(s) 221
LmnI GCTCC 3 cut(s) 363, 446, 502
LpnPI CCDG 6 cut(s) 38, 183, 306, 334, 413, 450
LweI GCATC 1 cut(s) 317
MaeI CTAG 2 cut(s) 99, 129
MaeIII GTNAC 1 cut(s) 436
MalI GATC 1 cut(s) 223
MboI GATC 1 cut(s) 221
MboII GAAGA 2 cut(s) 153, 279
MluCI AATT 4 cut(s) 197, 323, 533, 539
MnlI CCTC 6 cut(s) 9, 43, 237, 239, 401, 419
MseI TTAA 1 cut(s) 383
NcoI CCATGG 2 cut(s) 264, 526
NdeII GATC 1 cut(s) 221
NlaIII CATG 4 cut(s) 268, 462, 509, 530
NlaIV GGNNCC 2 cut(s) 371, 448
NmuCI GTSAC 1 cut(s) 436
NspI RCATGY 1 cut(s) 509
PaeI GCATGC 1 cut(s) 509
PfeI GAWTC 2 cut(s) 19, 375
PspN4I GGNNCC 2 cut(s) 371, 448
RsaI GTAC 2 cut(s) 55, 256
RsaNI GTAC 2 cut(s) 54, 255
SaqAI TTAA 1 cut(s) 383
Sau3AI GATC 1 cut(s) 221
SetI ASST 3 cut(s) 252, 346, 350
SfaNI GCATC 1 cut(s) 317
SphI GCATGC 1 cut(s) 509
Sse9I AATT 4 cut(s) 197, 323, 533, 539
SspMI CTAG 2 cut(s) 99, 129
StyI CCWWGG 2 cut(s) 264, 526
TaaI ACNGT 1 cut(s) 418
TasI AATT 4 cut(s) 197, 323, 533, 539
TatI WGTACW 1 cut(s) 254
TfiI GAWTC 2 cut(s) 19, 375
Tru1I TTAA 1 cut(s) 383
Tru9I TTAA 1 cut(s) 383
TscAI CASTG 1 cut(s) 421
TseFI GTSAC 1 cut(s) 436
Tsp45I GTSAC 1 cut(s) 436
TspDTI ATGAA 1 cut(s) 84
TspGWI ACGGA 1 cut(s) 224
TspRI CASTG 1 cut(s) 421
XapI RAATTY 2 cut(s) 197, 539
XceI RCATGY 1 cut(s) 509
XspI CTAG 2 cut(s) 99, 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.