RchiOBHm_Chr6g0271051

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0005165
Physical Location & Seq
Forward (+)
29100235 .. 29101189
955 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 480 bp
ATGTCGTTCATGAAAGGAGATTTACTTACTAAAACCAGAAAGCTGGTCAAAGGCTTGGGCAAGGCTGAGCCTGTTTGGTACAAAGCCATGGAACAAGCACCACCCCCAACATTTCCTCGTGCTGATGCAATTCAAAGGATCACTCTCCTAGAGGATGTTTACATAAAAAACCCATTTGGTCATCGGGTGCTTGAGTTGAAGGAGCAGAGGGCTTCTGAACAGGAAGCAATGACGGTAGCTGATATGGAATACCAGGCAGAGATAAAGGCAAAGAAGAAGGCATATGTTGCGTTGAAGAAAATTGCACGTCAACAAGGAAAGAGGCCTCCTCCCAACCCATATCCCATTGTTGTCAAGGAGATACAAGCTGAGGAGAAGAAGTATGTCTATGACCGTTTTCACAATCCAAGAATTTGCCAGATTTTAAGGAAACTGCAAAACTGCAAGAGGAAAAGGCAGTTGAGGATCAGGACAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

159

Amino Acids

18.68

Weight (kDa)

10.0

Isoelectric Point (pI)

46.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 146, 473
AcsI RAATTY 1 cut(s) 411
AfaI GTAC 1 cut(s) 80
AgsI TTSAA 3 cut(s) 134, 199, 295
AjiI CACGTC 1 cut(s) 308
AjnI CCWGG 1 cut(s) 252
AluBI AGCT 3 cut(s) 43, 239, 368
AluI AGCT 3 cut(s) 43, 239, 368
AlwI GGATC 2 cut(s) 146, 473
AoxI GGCC 1 cut(s) 323
ApoI RAATTY 1 cut(s) 411
BauI CACGAG 1 cut(s) 117
BbvCI CCTCAGC 1 cut(s) 369
BciT130I CCWGG 1 cut(s) 254
BfaI CTAG 1 cut(s) 149
BlpI GCTNAGC 1 cut(s) 66
Bme1390I CCNGG 1 cut(s) 254
BmgBI CACGTC 1 cut(s) 308
BmrFI CCNGG 1 cut(s) 254
BmsI GCATC 1 cut(s) 115
BplI GAGNNNNNCTC 2 cut(s) 313, 345
Bpu10I CCTNAGC 1 cut(s) 369
Bpu1102I GCTNAGC 1 cut(s) 66
BpuEI CTTGAG 1 cut(s) 212
BsaJI CCNNGG 1 cut(s) 87
BsaXI ACNNNNNCTCC 2 cut(s) 365, 395
Bse3DI GCAATG 1 cut(s) 234
BseBI CCWGG 1 cut(s) 254
BseDI CCNNGG 1 cut(s) 87
BseGI GGATG 1 cut(s) 160
BseMI GCAATG 1 cut(s) 234
BseMII CTCAG 2 cut(s) 57, 360
BseRI GAGGAG 2 cut(s) 318, 386
BshFI GGCC 1 cut(s) 325
BsnI GGCC 1 cut(s) 325
Bsp143I GATC 2 cut(s) 138, 465
Bsp1720I GCTNAGC 1 cut(s) 66
Bsp19I CCATGG 1 cut(s) 87
BspANI GGCC 1 cut(s) 325
BspCNI CTCAG 2 cut(s) 58, 361
BspHI TCATGA 1 cut(s) 9
BspPI GGATC 2 cut(s) 146, 473
BsrDI GCAATG 1 cut(s) 234
BssECI CCNNGG 1 cut(s) 87
BssMI GATC 2 cut(s) 138, 465
BssSI CACGAG 1 cut(s) 117
BssT1I CCWWGG 1 cut(s) 87
Bst2BI CACGAG 1 cut(s) 117
Bst2UI CCWGG 1 cut(s) 254
Bst4CI ACNGT 2 cut(s) 235, 395
BstAPI GCANNNNNTGC 1 cut(s) 287
BstDEI CTNAG 2 cut(s) 66, 369
BstDSI CCRYGG 1 cut(s) 87
BstF5I GGATG 1 cut(s) 160
BstKTI GATC 2 cut(s) 141, 468
BstMBI GATC 2 cut(s) 138, 465
BstMWI GCNNNNNNNGC 1 cut(s) 287
BstNI CCWGG 1 cut(s) 254
BstSCI CCNGG 1 cut(s) 252
BstXI CCANNNNNNTGG 1 cut(s) 43
BsuRI GGCC 1 cut(s) 325
BtgI CCRYGG 1 cut(s) 87
BtrI CACGTC 1 cut(s) 308
BtsCI GGATG 1 cut(s) 160
CciI TCATGA 1 cut(s) 9
Csp6I GTAC 1 cut(s) 79
CviAII CATG 2 cut(s) 10, 88
CviJI RGCY 9 cut(s) 43, 54, 65, 70, 86, 212, 239, 325, 368
CviKI_1 RGCY 9 cut(s) 43, 54, 65, 70, 86, 212, 239, 325, 368
CviQI GTAC 1 cut(s) 79
DdeI CTNAG 2 cut(s) 66, 369
DpnI GATC 2 cut(s) 140, 467
DpnII GATC 2 cut(s) 138, 465
Eco130I CCWWGG 1 cut(s) 87
Eco147I AGGCCT 1 cut(s) 325
EcoRII CCWGG 1 cut(s) 252
EcoT14I CCWWGG 1 cut(s) 87
ErhI CCWWGG 1 cut(s) 87
FaeI CATG 2 cut(s) 13, 91
FaiI YATR 9 cut(s) 11, 89, 164, 245, 283, 285, 340, 384, 390
FatI CATG 2 cut(s) 9, 87
FauNDI CATATG 1 cut(s) 283
FokI GGATG 1 cut(s) 167
FspBI CTAG 1 cut(s) 149
HaeIII GGCC 1 cut(s) 325
Hin1II CATG 2 cut(s) 13, 91
HincII GTYRAC 1 cut(s) 311
HindII GTYRAC 1 cut(s) 311
Hpy166II GTNNAC 2 cut(s) 160, 311
Hpy188I TCNGA 1 cut(s) 217
Hpy188III TCNNGA 2 cut(s) 10, 469
Hpy8I GTNNAC 2 cut(s) 160, 311
HpyAV CCTTC 2 cut(s) 193, 271
HpyCH4III ACNGT 2 cut(s) 235, 395
HpyCH4IV ACGT 1 cut(s) 307
HpyCH4V TGCA 4 cut(s) 128, 305, 436, 444
HpyF10VI GCNNNNNNNGC 1 cut(s) 287
HpyF3I CTNAG 2 cut(s) 66, 369
HpySE526I ACGT 1 cut(s) 307
Hsp92II CATG 2 cut(s) 13, 91
Kzo9I GATC 2 cut(s) 138, 465
LmnI GCTCC 1 cut(s) 202
LpnPI CCDG 8 cut(s) 29, 49, 84, 206, 239, 266, 431, 454
LweI GCATC 1 cut(s) 115
MaeI CTAG 1 cut(s) 149
MaeII ACGT 1 cut(s) 307
MalI GATC 2 cut(s) 140, 467
MboI GATC 2 cut(s) 138, 465
MboII GAAGA 3 cut(s) 286, 307, 388
MluCI AATT 3 cut(s) 129, 300, 411
MnlI CCTC 9 cut(s) 126, 145, 201, 315, 336, 339, 364, 441, 456
MseI TTAA 1 cut(s) 425
MspR9I CCNGG 1 cut(s) 254
MvaI CCWGG 1 cut(s) 254
MwoI GCNNNNNNNGC 1 cut(s) 287
NcoI CCATGG 1 cut(s) 87
NdeI CATATG 1 cut(s) 283
NdeII GATC 2 cut(s) 138, 465
NlaIII CATG 2 cut(s) 13, 91
PagI TCATGA 1 cut(s) 9
PceI AGGCCT 1 cut(s) 325
Psp6I CCWGG 1 cut(s) 252
PspGI CCWGG 1 cut(s) 252
RsaI GTAC 1 cut(s) 80
RsaNI GTAC 1 cut(s) 79
SaqAI TTAA 1 cut(s) 425
Sau3AI GATC 2 cut(s) 138, 465
ScrFI CCNGG 1 cut(s) 254
SetI ASST 4 cut(s) 45, 241, 310, 370
SfaNI GCATC 1 cut(s) 115
SmlI CTYRAG 1 cut(s) 191
SmoI CTYRAG 1 cut(s) 191
Sse9I AATT 3 cut(s) 129, 300, 411
SseBI AGGCCT 1 cut(s) 325
SspMI CTAG 1 cut(s) 149
StuI AGGCCT 1 cut(s) 325
StyD4I CCNGG 1 cut(s) 252
StyI CCWWGG 1 cut(s) 87
TaaI ACNGT 2 cut(s) 235, 395
TaiI ACGT 1 cut(s) 310
TasI AATT 3 cut(s) 129, 300, 411
Tru1I TTAA 1 cut(s) 425
Tru9I TTAA 1 cut(s) 425
TspDTI ATGAA 1 cut(s) 26
XapI RAATTY 1 cut(s) 411
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.