Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001565.1

Orthogroup ID

OG0005165

Physical Location & Seq

Genomic Coordinates Reverse (-)

314668 .. 315840

Gene Structure 1173 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001565.1_g000063.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 762 bp

atgtcattcatgaaaggagatttacttactaaaaccagaaagctggtcaaaggcttggccaaggctgagcctgtttggtacaaagccatggaacaagcaccacctccaacatttcctcgtgctgatgcaattcagaggatcactctcccagaggatgtttacataaaaaagttttttaagaagcatccagattccaaacatgaagacgcaatcaagttttctgcttttgatcctgctccagcccgtatatttggttgtcgggtgcttgagttgaaggagcagggggtttctgaacaggaagcaatggcggtggctgatatggaataccgggcagagataaaggcaaagaagaaggcatatgttgcgttgaagaaaattgcacgtcaacaaggaaagaggcctcctcccaacccatatcccaacgttatcaaggagatacaagctgaggagaaaaagtatgtctatgaccgttttcacaatccaagaattcgccagattttaaggaaactgcaagaggaaaaggcagttgaggatcaggacagaatgagagggggttggggtggcggtggcggtggcagtggtggtggtggtggcagtggtagtggtggtggtggtggttggggaagcagtggcagcggcggcggtggcatgggtggtggtggtggttggggaagcagtggcagtgctggagctggcatgggtggcggtggttggagaagcagtggcggtggcagtggcagtggtggttggggtggccggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

253

Amino Acids

26.74

Weight (kDa)

9.84

Isoelectric Point (pI)

53.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005165)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G26750
fragaria_vesca	FvH4_1g30250 FvH4_1g30250 FvH4_1g30250 FvH4_1g30250
malus_domestica	MD01G1063000.v1.1 MD07G1136300.v1.1
prunus_persica	Prupe.2G171300_v2.0.a1 Prupe.2G171300_v2.0.a1 Prupe.2G171300_v2.0.a1
pyrus_communis	pycom01g09340 pycom07g13360
rosa_chinensis	RchiOBHm_Chr6g0271051 RchiOBHm_Chr7g0220351
rosa_laevigata	RLG00000002228
rosa_multiflora	Rmu_sc0001136.1_g000086 Rmu_sc0001565.1_g000063
rosa_roxburghii	Rroxscaffold_3G00239510
rosa_rugosa	Rorug06G0058100 Rorug07G0193100
rosa_samantha	Rh6AG178100 Rh6BG181300 Rh6CG177100 Rh6DG169300 Rh7AG334400 Rh7BG325300 Rh7CG352100 Rh7DG331100
rosa_wichuraiana	Rw0G009890 Rw7G028270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	8 cut(s)	308, 564, 570, 636, 639, 642, 705, 726
AclI	AACGTT	1 cut(s)	423
AclWI	GGATC	3 cut(s)	146, 224, 540
AcoI	YGGCCR	2 cut(s)	57, 754
AcsI	RAATTY	1 cut(s)	486
AfaI	GTAC	1 cut(s)	80
AgsI	TTSAA	2 cut(s)	274, 370
AjiI	CACGTC	1 cut(s)	383
AluBI	AGCT	3 cut(s)	43, 443, 692
AluI	AGCT	3 cut(s)	43, 443, 692
AlwI	GGATC	3 cut(s)	146, 224, 540
AoxI	GGCC	3 cut(s)	57, 398, 754
ApeKI	GCWGC	1 cut(s)	633
ApoI	RAATTY	1 cut(s)	486
AsuC2I	CCSGG	1 cut(s)	329
BalI	TGGCCA	1 cut(s)	59
BauI	CACGAG	1 cut(s)	117
BbsI	GAAGAC	1 cut(s)	210
BbvCI	CCTCAGC	1 cut(s)	444
BbvI	GCAGC	1 cut(s)	645
BcnI	CCSGG	1 cut(s)	329
BisI	GCNGC	3 cut(s)	634, 637, 640
BlpI	GCTNAGC	1 cut(s)	66
BlsI	GCNGC	3 cut(s)	635, 638, 641
Bme1390I	CCNGG	1 cut(s)	329
BmgBI	CACGTC	1 cut(s)	383
BmrFI	CCNGG	1 cut(s)	329
BmsI	GCATC	2 cut(s)	115, 193
BpiI	GAAGAC	1 cut(s)	210
BplI	GAGNNNNNCTC	4 cut(s)	127, 159, 388, 420
BpmI	CTGGAG	2 cut(s)	222, 708
Bpu10I	CCTNAGC	1 cut(s)	444
Bpu1102I	GCTNAGC	1 cut(s)	66
BpuEI	CTTGAG	1 cut(s)	287
BpuMI	CCSGG	1 cut(s)	329
BsaJI	CCNNGG	2 cut(s)	60, 87
BsaXI	ACNNNNNCTCC	4 cut(s)	440, 470, 706, 736
Bse118I	RCCGGY	1 cut(s)	756
Bse3DI	GCAATG	1 cut(s)	309
BseDI	CCNNGG	2 cut(s)	60, 87
BseGI	GGATG	2 cut(s)	160, 184
BseMI	GCAATG	1 cut(s)	309
BseMII	CTCAG	2 cut(s)	57, 435
BseRI	GAGGAG	2 cut(s)	393, 461
BseXI	GCAGC	1 cut(s)	645
BshFI	GGCC	3 cut(s)	59, 400, 756
BsiSI	CCGG	2 cut(s)	328, 757
BsnI	GGCC	3 cut(s)	59, 400, 756
Bsp143I	GATC	3 cut(s)	138, 229, 532
Bsp1720I	GCTNAGC	1 cut(s)	66
Bsp19I	CCATGG	1 cut(s)	87
BspACI	CCGC	8 cut(s)	308, 564, 570, 636, 639, 642, 705, 726
BspANI	GGCC	3 cut(s)	59, 400, 756
BspCNI	CTCAG	2 cut(s)	58, 436
BspHI	TCATGA	1 cut(s)	9
BspPI	GGATC	3 cut(s)	146, 224, 540
BsrDI	GCAATG	1 cut(s)	309
BsrFI	RCCGGY	1 cut(s)	756
BssAI	RCCGGY	1 cut(s)	756
BssECI	CCNNGG	2 cut(s)	60, 87
BssMI	GATC	3 cut(s)	138, 229, 532
BssSI	CACGAG	1 cut(s)	117
BssT1I	CCWWGG	2 cut(s)	60, 87
Bst2BI	CACGAG	1 cut(s)	117
Bst4CI	ACNGT	1 cut(s)	470
BstAPI	GCANNNNNTGC	1 cut(s)	362
BstC8I	GCNNGC	1 cut(s)	694
BstDEI	CTNAG	2 cut(s)	66, 444
BstDSI	CCRYGG	1 cut(s)	87
BstF5I	GGATG	2 cut(s)	160, 184
BstKTI	GATC	3 cut(s)	141, 232, 535
BstMBI	GATC	3 cut(s)	138, 229, 532
BstMWI	GCNNNNNNNGC	5 cut(s)	362, 633, 639, 645, 702
BstSCI	CCNGG	1 cut(s)	327
BstV1I	GCAGC	1 cut(s)	645
BstV2I	GAAGAC	1 cut(s)	210
BstXI	CCANNNNNNTGG	1 cut(s)	43
BsuRI	GGCC	3 cut(s)	59, 400, 756
BtgI	CCRYGG	1 cut(s)	87
BtrI	CACGTC	1 cut(s)	383
BtsCI	GGATG	2 cut(s)	160, 184
BtsI	GCAGTG	8 cut(s)	583, 601, 634, 682, 688, 727, 739, 745
BtsIMutI	CAGTG	8 cut(s)	583, 601, 634, 682, 688, 727, 739, 745
Cac8I	GCNNGC	1 cut(s)	694
CciI	TCATGA	1 cut(s)	9
Cfr10I	RCCGGY	1 cut(s)	756
CseI	GACGC	1 cut(s)	215
Csp6I	GTAC	1 cut(s)	79
CspCI	CAANNNNNGTGG	2 cut(s)	291, 326
CviAII	CATG	5 cut(s)	10, 88, 200, 649, 697
CviQI	GTAC	1 cut(s)	79
DdeI	CTNAG	2 cut(s)	66, 444
DpnI	GATC	3 cut(s)	140, 231, 534
DpnII	GATC	3 cut(s)	138, 229, 532
EaeI	YGGCCR	2 cut(s)	57, 754
Eco130I	CCWWGG	2 cut(s)	60, 87
Eco147I	AGGCCT	1 cut(s)	400
EcoRI	GAATTC	1 cut(s)	486
EcoT14I	CCWWGG	2 cut(s)	60, 87
ErhI	CCWWGG	2 cut(s)	60, 87
FaeI	CATG	5 cut(s)	13, 91, 203, 652, 700
FatI	CATG	5 cut(s)	9, 87, 199, 648, 696
FauNDI	CATATG	1 cut(s)	358
Fnu4HI	GCNGC	3 cut(s)	634, 637, 640
FokI	GGATG	2 cut(s)	167, 171
Fsp4HI	GCNGC	3 cut(s)	634, 637, 640
GluI	GCNGC	3 cut(s)	634, 637, 640
GsuI	CTGGAG	2 cut(s)	222, 708
HaeIII	GGCC	3 cut(s)	59, 400, 756
HapII	CCGG	2 cut(s)	328, 757
HgaI	GACGC	1 cut(s)	215
Hin1II	CATG	5 cut(s)	13, 91, 203, 652, 700
HincII	GTYRAC	1 cut(s)	386
HindII	GTYRAC	1 cut(s)	386
HinfI	GANTC	1 cut(s)	191
HpaII	CCGG	2 cut(s)	328, 757
Hpy166II	GTNNAC	2 cut(s)	160, 386
Hpy188I	TCNGA	2 cut(s)	135, 292
Hpy188III	TCNNGA	3 cut(s)	10, 188, 536
Hpy8I	GTNNAC	2 cut(s)	160, 386
HpyAV	CCTTC	2 cut(s)	268, 346
HpyCH4III	ACNGT	1 cut(s)	470
HpyCH4IV	ACGT	2 cut(s)	382, 423
HpyCH4V	TGCA	3 cut(s)	128, 380, 511
HpyF10VI	GCNNNNNNNGC	5 cut(s)	362, 633, 639, 645, 702
HpyF3I	CTNAG	2 cut(s)	66, 444
HpySE526I	ACGT	2 cut(s)	382, 423
Hsp92II	CATG	5 cut(s)	13, 91, 203, 652, 700
Kzo9I	GATC	3 cut(s)	138, 229, 532
LmnI	GCTCC	3 cut(s)	241, 277, 689
Lsp1109I	GCAGC	1 cut(s)	645
LweI	GCATC	2 cut(s)	115, 193
MaeII	ACGT	2 cut(s)	382, 423
MalI	GATC	3 cut(s)	140, 231, 534
MboI	GATC	3 cut(s)	138, 229, 532
MboII	GAAGA	3 cut(s)	215, 361, 382
MlsI	TGGCCA	1 cut(s)	59
MluCI	AATT	3 cut(s)	129, 375, 486
MluNI	TGGCCA	1 cut(s)	59
MmeI	TCCRAC	2 cut(s)	131, 692
Mox20I	TGGCCA	1 cut(s)	59
MscI	TGGCCA	1 cut(s)	59
MseI	TTAA	2 cut(s)	177, 500
Msp20I	TGGCCA	1 cut(s)	59
MspA1I	CMGCKG	1 cut(s)	636
MspI	CCGG	2 cut(s)	328, 757
MspR9I	CCNGG	1 cut(s)	329
MwoI	GCNNNNNNNGC	5 cut(s)	362, 633, 639, 645, 702
NciI	CCSGG	1 cut(s)	329
NcoI	CCATGG	1 cut(s)	87
NdeI	CATATG	1 cut(s)	358
NdeII	GATC	3 cut(s)	138, 229, 532
NlaIII	CATG	5 cut(s)	13, 91, 203, 652, 700
PagI	TCATGA	1 cut(s)	9
PceI	AGGCCT	1 cut(s)	400
PfeI	GAWTC	1 cut(s)	191
PkrI	GCNGC	3 cut(s)	635, 638, 641
Psp1406I	AACGTT	1 cut(s)	423
RsaI	GTAC	1 cut(s)	80
RsaNI	GTAC	1 cut(s)	79
SaqAI	TTAA	2 cut(s)	177, 500
SatI	GCNGC	3 cut(s)	634, 637, 640
Sau3AI	GATC	3 cut(s)	138, 229, 532
ScrFI	CCNGG	1 cut(s)	329
SetI	ASST	6 cut(s)	45, 106, 385, 426, 445, 694
SfaNI	GCATC	2 cut(s)	115, 193
SmlI	CTYRAG	1 cut(s)	266
SmoI	CTYRAG	1 cut(s)	266
Sse9I	AATT	3 cut(s)	129, 375, 486
SseBI	AGGCCT	1 cut(s)	400
SsiI	CCGC	8 cut(s)	308, 564, 570, 636, 639, 642, 705, 726
StuI	AGGCCT	1 cut(s)	400
StyD4I	CCNGG	1 cut(s)	327
StyI	CCWWGG	2 cut(s)	60, 87
TaaI	ACNGT	1 cut(s)	470
TaiI	ACGT	2 cut(s)	385, 426
TasI	AATT	3 cut(s)	129, 375, 486
TauI	GCSGC	2 cut(s)	639, 642
TfiI	GAWTC	1 cut(s)	191
Tru1I	TTAA	2 cut(s)	177, 500
Tru9I	TTAA	2 cut(s)	177, 500
TscAI	CASTG	8 cut(s)	583, 601, 634, 682, 688, 727, 739, 745
TseI	GCWGC	1 cut(s)	633
TspDTI	ATGAA	2 cut(s)	26, 216
TspRI	CASTG	8 cut(s)	583, 601, 634, 682, 688, 727, 739, 745
XapI	RAATTY	1 cut(s)	486

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.