RchiOBHm_Chr5g0066701

Calcium-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
72756954 .. 72761073
4120 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGGATGGAGAAACTATTGTTTACACATCTGTTTGTTTGGCTGATGCTCCAAGTGAACCTGGAGGCTTTTTCAAACGAGAAGGAACGGCAAAAGATCATGAGGTCATAGTCGAGCATTTGTCAGTTGAGGAAATAGCTGGCATAAAGGAGGCATTTCAATTGATGGATACTGACAACAAAGGCAAGGTATCCCTGGATCAGCTTCGAAATGGAATACAAGAACTCAGCTAG

Protein Analysis

76

Amino Acids

8.31

Weight (kDa)

4.48

Isoelectric Point (pI)

23.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_6 PF13405 48 - 75 1.2e-06 EF-hand domain
EF-hand_1 PF00036 48 - 74 2.2e-06 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 204
AgsI TTSAA 2 cut(s) 73, 158
AjnI CCWGG 2 cut(s) 58, 192
AluBI AGCT 3 cut(s) 137, 202, 228
AluI AGCT 3 cut(s) 137, 202, 228
AlwI GGATC 1 cut(s) 204
AsuII TTCGAA 1 cut(s) 205
BccI CCATC 1 cut(s) 157
BceAI ACGGC 1 cut(s) 102
BciT130I CCWGG 2 cut(s) 60, 194
BciVI GTATCC 2 cut(s) 160, 199
BfaI CTAG 1 cut(s) 229
BfuI GTATCC 2 cut(s) 160, 199
Bme1390I CCNGG 2 cut(s) 60, 194
BmrFI CCNGG 2 cut(s) 60, 194
BmsI GCATC 1 cut(s) 34
BpmI CTGGAG 1 cut(s) 81
Bpu14I TTCGAA 1 cut(s) 205
BsaJI CCNNGG 1 cut(s) 192
BseBI CCWGG 2 cut(s) 60, 194
BseDI CCNNGG 1 cut(s) 192
BseGI GGATG 1 cut(s) 10
Bsp119I TTCGAA 1 cut(s) 205
Bsp143I GATC 2 cut(s) 94, 196
BspHI TCATGA 1 cut(s) 97
BspPI GGATC 1 cut(s) 204
BspT104I TTCGAA 1 cut(s) 205
BssECI CCNNGG 1 cut(s) 192
BssMI GATC 2 cut(s) 94, 196
Bst2UI CCWGG 2 cut(s) 60, 194
BstBI TTCGAA 1 cut(s) 205
BstC8I GCNNGC 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 224
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 2 cut(s) 97, 199
BstMBI GATC 2 cut(s) 94, 196
BstNI CCWGG 2 cut(s) 60, 194
BstSCI CCNGG 2 cut(s) 58, 192
BsuI GTATCC 2 cut(s) 160, 199
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 139
CciI TCATGA 1 cut(s) 97
CviAII CATG 1 cut(s) 98
CviJI RGCY 5 cut(s) 41, 66, 137, 202, 228
CviKI_1 RGCY 5 cut(s) 41, 66, 137, 202, 228
DdeI CTNAG 1 cut(s) 224
DpnI GATC 2 cut(s) 96, 198
DpnII GATC 2 cut(s) 94, 196
EcoRII CCWGG 2 cut(s) 58, 192
FaeI CATG 1 cut(s) 101
FaiI YATR 3 cut(s) 99, 107, 143
FatI CATG 1 cut(s) 97
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 229
GsuI CTGGAG 1 cut(s) 81
Hin1II CATG 1 cut(s) 101
Hpy166II GTNNAC 2 cut(s) 22, 56
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 2 cut(s) 22, 56
HpyAV CCTTC 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 224
Hsp92II CATG 1 cut(s) 101
Kzo9I GATC 2 cut(s) 94, 196
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 5 cut(s) 45, 72, 123, 179, 206
LweI GCATC 1 cut(s) 34
MaeI CTAG 1 cut(s) 229
MalI GATC 2 cut(s) 96, 198
MboI GATC 2 cut(s) 94, 196
MfeI CAATTG 1 cut(s) 158
MluCI AATT 1 cut(s) 158
MnlI CCTC 4 cut(s) 56, 94, 121, 142
MspR9I CCNGG 2 cut(s) 60, 194
MunI CAATTG 1 cut(s) 158
MvaI CCWGG 2 cut(s) 60, 194
NdeII GATC 2 cut(s) 94, 196
NlaIII CATG 1 cut(s) 101
NspV TTCGAA 1 cut(s) 205
PagI TCATGA 1 cut(s) 97
Psp6I CCWGG 2 cut(s) 58, 192
PspGI CCWGG 2 cut(s) 58, 192
Sau3AI GATC 2 cut(s) 94, 196
ScrFI CCNGG 2 cut(s) 60, 194
SetI ASST 6 cut(s) 61, 105, 139, 189, 204, 230
SfaNI GCATC 1 cut(s) 34
SfuI TTCGAA 1 cut(s) 205
Sse9I AATT 1 cut(s) 158
SspMI CTAG 1 cut(s) 229
StyD4I CCNGG 2 cut(s) 58, 192
TaqI TCGA 2 cut(s) 111, 205
TasI AATT 1 cut(s) 158
XspI CTAG 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.