Rh2CG628200

Calcium-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
80182343 .. 80182908
566 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG628200.1

Sequence Viewer

Length: 174 bp
ATGCTTGATCCTGACCCCAAGAAGCGGCTGACAGCTCAAGAAGTCATAGCCAAGCATTTGTCGGTTGAGGAAGTAGCTAGCATAAAGGAGGCATTTCAACTGATGGATACTGACAACAAAGGCAAGGTATCCCTCGGTCAGCTTCGAAATGGAATACAAAAACTTGGCCAGTAG

Protein Analysis

57

Amino Acids

6.32

Weight (kDa)

8.09

Isoelectric Point (pI)

18.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_6 PF13405 28 - 56 6.3e-07 EF-hand domain
EF-hand_1 PF00036 28 - 55 4.8e-06 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 25
AclWI GGATC 1 cut(s) 2
AcoI YGGCCR 1 cut(s) 166
AfiI CCNNNNNNNGG 1 cut(s) 24
AgsI TTSAA 1 cut(s) 98
AluBI AGCT 3 cut(s) 35, 77, 142
AluI AGCT 3 cut(s) 35, 77, 142
AlwI GGATC 1 cut(s) 2
AoxI GGCC 1 cut(s) 166
AsuII TTCGAA 1 cut(s) 145
AsuNHI GCTAGC 1 cut(s) 77
BalI TGGCCA 1 cut(s) 168
BccI CCATC 1 cut(s) 97
BciVI GTATCC 2 cut(s) 100, 139
BfaI CTAG 1 cut(s) 78
BfuI GTATCC 2 cut(s) 100, 139
BisI GCNGC 1 cut(s) 26
BlsI GCNGC 1 cut(s) 27
BmtI GCTAGC 1 cut(s) 81
Bpu14I TTCGAA 1 cut(s) 145
BpuEI CTTGAG 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 133
Bsc4I CCNNNNNNNGG 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 169
BseDI CCNNGG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 24
BseNI ACTGG 1 cut(s) 169
BshFI GGCC 1 cut(s) 168
BslI CCNNNNNNNGG 1 cut(s) 24
BsnI GGCC 1 cut(s) 168
Bsp119I TTCGAA 1 cut(s) 145
Bsp143I GATC 1 cut(s) 7
BspACI CCGC 1 cut(s) 25
BspANI GGCC 1 cut(s) 168
BspOI GCTAGC 1 cut(s) 81
BspPI GGATC 1 cut(s) 2
BspT104I TTCGAA 1 cut(s) 145
BsrI ACTGG 1 cut(s) 169
BssECI CCNNGG 1 cut(s) 133
BssMI GATC 1 cut(s) 7
BstBI TTCGAA 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 79
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BsuI GTATCC 2 cut(s) 100, 139
BsuRI GGCC 1 cut(s) 168
Cac8I GCNNGC 1 cut(s) 79
CviJI RGCY 6 cut(s) 28, 35, 50, 77, 142, 168
CviKI_1 RGCY 6 cut(s) 28, 35, 50, 77, 142, 168
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
EaeI YGGCCR 1 cut(s) 166
FaiI YATR 2 cut(s) 47, 83
Fnu4HI GCNGC 1 cut(s) 26
Fsp4HI GCNGC 1 cut(s) 26
FspBI CTAG 1 cut(s) 78
GluI GCNGC 1 cut(s) 26
HaeIII GGCC 1 cut(s) 168
Hpy188III TCNNGA 2 cut(s) 11, 38
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 1 cut(s) 24
MaeI CTAG 1 cut(s) 78
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MlsI TGGCCA 1 cut(s) 168
MluNI TGGCCA 1 cut(s) 168
MnlI CCTC 3 cut(s) 61, 82, 143
Mox20I TGGCCA 1 cut(s) 168
MscI TGGCCA 1 cut(s) 168
Msp20I TGGCCA 1 cut(s) 168
NdeII GATC 1 cut(s) 7
NheI GCTAGC 1 cut(s) 77
NspV TTCGAA 1 cut(s) 145
PkrI GCNGC 1 cut(s) 27
SatI GCNGC 1 cut(s) 26
Sau3AI GATC 1 cut(s) 7
SetI ASST 4 cut(s) 37, 79, 129, 144
SfuI TTCGAA 1 cut(s) 145
SgeI CNNG 8 cut(s) 17, 23, 31, 50, 64, 90, 136, 146
SmlI CTYRAG 1 cut(s) 36
SmoI CTYRAG 1 cut(s) 36
SsiI CCGC 1 cut(s) 25
SspMI CTAG 1 cut(s) 78
TaqI TCGA 1 cut(s) 145
TaqII GACCGA 1 cut(s) 125
TauI GCSGC 1 cut(s) 28
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.