RchiOBHm_Chr1g0318391

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
5897373 .. 5899405
2033 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54868

Sequence Viewer

Length: 132 bp
ATGTTATGGGCTTCGAGCTTAGCAAATTACAATTCGGTTTCGATATCCTGGATTATAGGTTTGTTTTTGGACCACATAGAGGAAGCTGAGAAATCATTTGTTGCGAAGCTGAGATATGCGAGCGTTCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

43

Amino Acids

4.89

Weight (kDa)

5.51

Isoelectric Point (pI)

50.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 1 cut(s) 128
AjnI CCWGG 1 cut(s) 47
AluBI AGCT 3 cut(s) 18, 86, 109
AluI AGCT 3 cut(s) 18, 86, 109
AspS9I GGNCC 1 cut(s) 70
AvaII GGWCC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 49
BlpI GCTNAGC 1 cut(s) 19
Bme1390I CCNGG 1 cut(s) 49
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmrFI CCNGG 1 cut(s) 49
Bpu1102I GCTNAGC 1 cut(s) 19
Bsc4I CCNNNNNNNGG 1 cut(s) 79
BseBI CCWGG 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMII CTCAG 2 cut(s) 78, 101
BslI CCNNNNNNNGG 1 cut(s) 79
Bsp1720I GCTNAGC 1 cut(s) 19
BspCNI CTCAG 2 cut(s) 79, 102
Bst2UI CCWGG 1 cut(s) 49
BstC8I GCNNGC 1 cut(s) 121
BstDEI CTNAG 3 cut(s) 19, 87, 110
BstNI CCWGG 1 cut(s) 49
BstSCI CCNGG 1 cut(s) 47
Cac8I GCNNGC 1 cut(s) 121
Cfr13I GGNCC 1 cut(s) 70
CviJI RGCY 4 cut(s) 11, 18, 86, 109
CviKI_1 RGCY 4 cut(s) 11, 18, 86, 109
DdeI CTNAG 3 cut(s) 19, 87, 110
Eco32I GATATC 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 47
EcoRV GATATC 1 cut(s) 45
FaiI YATR 4 cut(s) 7, 56, 77, 117
FspEI CC 7 cut(s) 20, 34, 42, 53, 61, 65, 86
HpyF3I CTNAG 3 cut(s) 19, 87, 110
LpnPI CCDG 2 cut(s) 34, 61
MluCI AATT 2 cut(s) 25, 31
MnlI CCTC 1 cut(s) 73
MspR9I CCNGG 1 cut(s) 49
MvaI CCWGG 1 cut(s) 49
PfoI TCCNGGA 1 cut(s) 47
Psp6I CCWGG 1 cut(s) 47
PspGI CCWGG 1 cut(s) 47
PspPI GGNCC 1 cut(s) 70
Sau96I GGNCC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 49
SetI ASST 4 cut(s) 20, 61, 88, 111
SgeI CNNG 3 cut(s) 27, 60, 61
SinI GGWCC 1 cut(s) 70
Sse9I AATT 2 cut(s) 25, 31
StyD4I CCNGG 1 cut(s) 47
TaqI TCGA 2 cut(s) 14, 41
TasI AATT 2 cut(s) 25, 31
VpaK11BI GGWCC 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.