RchiOBHm_Chr5g0081421

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
87388228 .. 87389165
938 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGGCCGCTATATCTGAGCTGCTGCAACGTTTGCTGGTGATTTCGCCTTTGCTTTTAGTGATTGTCGTTCATTGGCTCTCCACAGGCAGCCAGATCACCATTGGGATTCCAGGGTCTGAGCCTGAAGCTATCCACAGAGCTGGAGGATCACCTTGGGGTGTGGCCTTTGTTTTAGTACTGCTTTTCTTTCTCATATCCTATCAGCCTTCTTTCCTTGGCCTTCTTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.21

Weight (kDa)

5.98

Isoelectric Point (pI)

43.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 6
AclI AACGTT 1 cut(s) 28
AclWI GGATC 1 cut(s) 154
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 144
AfaI GTAC 1 cut(s) 177
AjnI CCWGG 1 cut(s) 109
AluBI AGCT 3 cut(s) 19, 128, 140
AluI AGCT 3 cut(s) 19, 128, 140
AlwI GGATC 1 cut(s) 154
AlwNI CAGNNNCTG 1 cut(s) 116
AoxI GGCC 3 cut(s) 3, 162, 217
ApeKI GCWGC 3 cut(s) 19, 22, 87
AsuHPI GGTGA 3 cut(s) 49, 88, 141
BbvI GCAGC 3 cut(s) 6, 9, 99
BciT130I CCWGG 1 cut(s) 111
BfaI CTAG 1 cut(s) 229
BisI GCNGC 4 cut(s) 6, 20, 23, 88
BlsI GCNGC 4 cut(s) 7, 21, 24, 89
BmcAI AGTACT 1 cut(s) 177
Bme1390I CCNGG 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 111
BpmI CTGGAG 1 cut(s) 162
BsaJI CCNNGG 3 cut(s) 110, 152, 214
BseBI CCWGG 1 cut(s) 111
BseDI CCNNGG 3 cut(s) 110, 152, 214
BseMII CTCAG 2 cut(s) 6, 108
BseXI GCAGC 3 cut(s) 6, 9, 99
BshFI GGCC 3 cut(s) 5, 164, 219
BsnI GGCC 3 cut(s) 5, 164, 219
Bsp143I GATC 2 cut(s) 93, 146
BspACI CCGC 1 cut(s) 6
BspANI GGCC 3 cut(s) 5, 164, 219
BspCNI CTCAG 2 cut(s) 7, 109
BspPI GGATC 1 cut(s) 154
BssECI CCNNGG 3 cut(s) 110, 152, 214
BssMI GATC 2 cut(s) 93, 146
BssT1I CCWWGG 2 cut(s) 152, 214
Bst2UI CCWGG 1 cut(s) 111
BstAPI GCANNNNNTGC 1 cut(s) 31
BstDEI CTNAG 2 cut(s) 15, 117
BstKTI GATC 2 cut(s) 96, 149
BstMBI GATC 2 cut(s) 93, 146
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstNI CCWGG 1 cut(s) 111
BstSCI CCNGG 1 cut(s) 109
BstV1I GCAGC 3 cut(s) 6, 9, 99
BstXI CCANNNNNNTGG 1 cut(s) 140
BsuRI GGCC 3 cut(s) 5, 164, 219
CaiI CAGNNNCTG 1 cut(s) 116
Csp6I GTAC 1 cut(s) 176
CviQI GTAC 1 cut(s) 176
DdeI CTNAG 2 cut(s) 15, 117
DpnI GATC 2 cut(s) 95, 148
DpnII GATC 2 cut(s) 93, 146
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 2 cut(s) 152, 214
Eco57I CTGAAG 1 cut(s) 144
EcoRII CCWGG 1 cut(s) 109
EcoT14I CCWWGG 2 cut(s) 152, 214
ErhI CCWWGG 2 cut(s) 152, 214
FaiI YATR 2 cut(s) 11, 194
Fnu4HI GCNGC 4 cut(s) 6, 20, 23, 88
Fsp4HI GCNGC 4 cut(s) 6, 20, 23, 88
FspBI CTAG 1 cut(s) 229
GluI GCNGC 4 cut(s) 6, 20, 23, 88
GsuI CTGGAG 1 cut(s) 162
HaeIII GGCC 3 cut(s) 5, 164, 219
HinfI GANTC 1 cut(s) 106
HphI GGTGA 3 cut(s) 49, 88, 141
Hpy188I TCNGA 2 cut(s) 16, 118
HpyAV CCTTC 2 cut(s) 216, 230
HpyCH4IV ACGT 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 25
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpyF3I CTNAG 2 cut(s) 15, 117
HpySE526I ACGT 1 cut(s) 28
Kzo9I GATC 2 cut(s) 93, 146
LpnPI CCDG 7 cut(s) 20, 69, 96, 104, 123, 126, 135
Lsp1109I GCAGC 3 cut(s) 6, 9, 99
MaeI CTAG 1 cut(s) 229
MaeII ACGT 1 cut(s) 28
MalI GATC 2 cut(s) 95, 148
MboI GATC 2 cut(s) 93, 146
MnlI CCTC 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 111
MwoI GCNNNNNNNGC 1 cut(s) 31
NdeII GATC 2 cut(s) 93, 146
PfeI GAWTC 1 cut(s) 106
PkrI GCNGC 4 cut(s) 7, 21, 24, 89
Psp1406I AACGTT 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
PstNI CAGNNNCTG 1 cut(s) 116
RsaI GTAC 1 cut(s) 177
RsaNI GTAC 1 cut(s) 176
SatI GCNGC 4 cut(s) 6, 20, 23, 88
Sau3AI GATC 2 cut(s) 93, 146
ScaI AGTACT 1 cut(s) 177
ScrFI CCNGG 1 cut(s) 111
SetI ASST 5 cut(s) 21, 31, 130, 142, 154
SgeI CNNG 9 cut(s) 47, 96, 103, 122, 123, 134, 153, 165, 227
SsiI CCGC 1 cut(s) 6
SspMI CTAG 1 cut(s) 229
StyD4I CCNGG 1 cut(s) 109
StyI CCWWGG 2 cut(s) 152, 214
TaiI ACGT 1 cut(s) 31
TatI WGTACW 1 cut(s) 175
TauI GCSGC 1 cut(s) 8
TfiI GAWTC 1 cut(s) 106
TseI GCWGC 3 cut(s) 19, 22, 87
TspDTI ATGAA 1 cut(s) 59
XcmI CCANNNNNNNNNTGG 1 cut(s) 98
XspI CTAG 1 cut(s) 229
ZrmI AGTACT 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.