Rmu_sc0007768.1_g000023

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007768.1
Physical Location & Seq
Forward (+)
97197 .. 97544
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007768.1_g000023.1.cds

Sequence Viewer

Length: 348 bp
atggcttcagcttccagatcaagttctttgcttttcaatctcacagataactggctcctaattgctactacgacactcatctgtgtatttgcaggttatgttgtttacgacgctgtaatggccactatatccgagctgctgcgacgtttgctggtgatttcgcctttgcttttagtgattgtggttcattggctctccacaggcagccaggtcaacattgggattccggggtctgagccgggagctatcaacagagctgggggatcaccttggggtgtggcctttgttttagtactgcttttctttctcatatcctatcagccttctttccttggccttcttttctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

12.39

Weight (kDa)

6.51

Isoelectric Point (pI)

46.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 83
AclWI GGATC 1 cut(s) 271
AcoI YGGCCR 1 cut(s) 120
AfaI GTAC 1 cut(s) 294
AgsI TTSAA 1 cut(s) 37
AjnI CCWGG 1 cut(s) 207
AluBI AGCT 4 cut(s) 11, 136, 245, 257
AluI AGCT 4 cut(s) 11, 136, 245, 257
AlwI GGATC 1 cut(s) 271
AoxI GGCC 3 cut(s) 120, 279, 334
ApeKI GCWGC 3 cut(s) 136, 139, 204
AsuC2I CCSGG 2 cut(s) 228, 240
AsuHPI GGTGA 2 cut(s) 166, 258
BalI TGGCCA 1 cut(s) 122
BbvI GCAGC 3 cut(s) 123, 126, 216
BciT130I CCWGG 1 cut(s) 209
BcnI CCSGG 2 cut(s) 228, 240
BfaI CTAG 1 cut(s) 346
BfuAI ACCTGC 1 cut(s) 83
BisI GCNGC 3 cut(s) 137, 140, 205
BlsI GCNGC 3 cut(s) 138, 141, 206
BmcAI AGTACT 1 cut(s) 294
Bme1390I CCNGG 3 cut(s) 209, 228, 240
BmiI GGNNCC 1 cut(s) 56
BmrFI CCNGG 3 cut(s) 209, 228, 240
BpuMI CCSGG 2 cut(s) 228, 240
BsaJI CCNNGG 3 cut(s) 227, 269, 331
Bse1I ACTGG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 209
BseDI CCNNGG 3 cut(s) 227, 269, 331
BseMII CTCAG 1 cut(s) 225
BseNI ACTGG 1 cut(s) 56
BseXI GCAGC 3 cut(s) 123, 126, 216
BseYI CCCAGC 1 cut(s) 257
BshFI GGCC 3 cut(s) 122, 281, 336
BsiSI CCGG 2 cut(s) 227, 239
BsnI GGCC 3 cut(s) 122, 281, 336
Bsp143I GATC 2 cut(s) 17, 263
BspANI GGCC 3 cut(s) 122, 281, 336
BspCNI CTCAG 1 cut(s) 226
BspLI GGNNCC 1 cut(s) 56
BspMI ACCTGC 1 cut(s) 83
BspPI GGATC 1 cut(s) 271
BsrI ACTGG 1 cut(s) 56
BssECI CCNNGG 3 cut(s) 227, 269, 331
BssMI GATC 2 cut(s) 17, 263
BssT1I CCWWGG 2 cut(s) 269, 331
Bst2UI CCWGG 1 cut(s) 209
BstDEI CTNAG 1 cut(s) 234
BstKTI GATC 2 cut(s) 20, 266
BstMBI GATC 2 cut(s) 17, 263
BstMWI GCNNNNNNNGC 2 cut(s) 119, 148
BstNI CCWGG 1 cut(s) 209
BstSCI CCNGG 3 cut(s) 207, 226, 238
BstV1I GCAGC 3 cut(s) 123, 126, 216
BsuRI GGCC 3 cut(s) 122, 281, 336
BveI ACCTGC 1 cut(s) 83
CseI GACGC 1 cut(s) 119
Csp6I GTAC 1 cut(s) 293
CviQI GTAC 1 cut(s) 293
DdeI CTNAG 1 cut(s) 234
DpnI GATC 2 cut(s) 19, 265
DpnII GATC 2 cut(s) 17, 263
EaeI YGGCCR 1 cut(s) 120
Eco130I CCWWGG 2 cut(s) 269, 331
EcoRII CCWGG 1 cut(s) 207
EcoT14I CCWWGG 2 cut(s) 269, 331
ErhI CCWWGG 2 cut(s) 269, 331
FaiI YATR 3 cut(s) 99, 128, 311
Fnu4HI GCNGC 3 cut(s) 137, 140, 205
Fsp4HI GCNGC 3 cut(s) 137, 140, 205
FspBI CTAG 1 cut(s) 346
GluI GCNGC 3 cut(s) 137, 140, 205
GsaI CCCAGC 1 cut(s) 261
HaeIII GGCC 3 cut(s) 122, 281, 336
HapII CCGG 2 cut(s) 227, 239
HgaI GACGC 1 cut(s) 119
HincII GTYRAC 1 cut(s) 214
HindII GTYRAC 1 cut(s) 214
HinfI GANTC 1 cut(s) 223
HpaII CCGG 2 cut(s) 227, 239
HphI GGTGA 2 cut(s) 166, 258
Hpy166II GTNNAC 2 cut(s) 106, 214
Hpy188I TCNGA 2 cut(s) 133, 235
Hpy188III TCNNGA 1 cut(s) 15
Hpy8I GTNNAC 2 cut(s) 106, 214
Hpy99I CGWCG 2 cut(s) 113, 147
HpyAV CCTTC 2 cut(s) 333, 347
HpyCH4IV ACGT 1 cut(s) 145
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 2 cut(s) 119, 148
HpyF3I CTNAG 1 cut(s) 234
HpySE526I ACGT 1 cut(s) 145
Kzo9I GATC 2 cut(s) 17, 263
LmnI GCTCC 2 cut(s) 60, 242
Lsp1109I GCAGC 3 cut(s) 123, 126, 216
MaeI CTAG 1 cut(s) 346
MaeII ACGT 1 cut(s) 145
MalI GATC 2 cut(s) 19, 265
MboI GATC 2 cut(s) 17, 263
MlsI TGGCCA 1 cut(s) 122
MluCI AATT 1 cut(s) 60
MluNI TGGCCA 1 cut(s) 122
Mox20I TGGCCA 1 cut(s) 122
MscI TGGCCA 1 cut(s) 122
Msp20I TGGCCA 1 cut(s) 122
MspI CCGG 2 cut(s) 227, 239
MspR9I CCNGG 3 cut(s) 209, 228, 240
MvaI CCWGG 1 cut(s) 209
MwoI GCNNNNNNNGC 2 cut(s) 119, 148
NciI CCSGG 2 cut(s) 228, 240
NdeII GATC 2 cut(s) 17, 263
NlaIV GGNNCC 1 cut(s) 56
PfeI GAWTC 1 cut(s) 223
PkrI GCNGC 3 cut(s) 138, 141, 206
Psp6I CCWGG 1 cut(s) 207
PspFI CCCAGC 1 cut(s) 257
PspGI CCWGG 1 cut(s) 207
PspN4I GGNNCC 1 cut(s) 56
RsaI GTAC 1 cut(s) 294
RsaNI GTAC 1 cut(s) 293
SatI GCNGC 3 cut(s) 137, 140, 205
Sau3AI GATC 2 cut(s) 17, 263
ScaI AGTACT 1 cut(s) 294
ScrFI CCNGG 3 cut(s) 209, 228, 240
SetI ASST 8 cut(s) 13, 97, 138, 148, 213, 247, 259, 271
Sse9I AATT 1 cut(s) 60
SspMI CTAG 1 cut(s) 346
StyD4I CCNGG 3 cut(s) 207, 226, 238
StyI CCWWGG 2 cut(s) 269, 331
TaiI ACGT 1 cut(s) 148
TasI AATT 1 cut(s) 60
TatI WGTACW 1 cut(s) 292
TfiI GAWTC 1 cut(s) 223
TseI GCWGC 3 cut(s) 136, 139, 204
TspDTI ATGAA 1 cut(s) 176
XcmI CCANNNNNNNNNTGG 1 cut(s) 215
XspI CTAG 1 cut(s) 346
ZrmI AGTACT 1 cut(s) 294
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.